Kingfisher flex magnetic particle processor

All tracheal and cloacal swabs collected in live birds of houses 3 and 1 were sent to the diagnostic laboratory (National Reference Centre for Avian Influenza in Istituto Zooprofilattico Sperimentale delle Venezie) and submitted for Avian Influenza Virus Type A (AIV) rRT-PCR [6 (link)]. Briefly, swabs were individually moved into single tubes, containing a sufficient amount of PBS (with antibiotics) to ensure their full immersion (1 mL), thus swabs suspensions were vortexed for 30 s and centrifuged for 2 min at 15,000× g and the supernatant harvested for RNA extraction.
RNA extraction and Real-Time RT-PCR for AIV: nucleic acid extraction was performed using QIAsymphony DSP Virus/Pathogen Kit (Qiagen, Hilden, Germany) or MagMAX Pathogen RNA/DNA Kit (Applied Biosystems, Waltham, MA, USA) on the QIAsymphony SP instrument (Qiagen) and KingFisher Flex Magnetic Particle Processor (Thermofisher Scientific, Waltham, MA, USA), respectively. Amplification reaction was assembled with the AgPath-ID One-Step RT-PCR Reagents (Applied Biosystems), using CFX 96 Deep well Real-Time PCR System, C1000 Touch (Biorad, Hercules, CA, USA) as platform.

DNA from microscopy-quantified blood-stage parasites [33 ] was extracted from 5 µl of blood using a semi-automatic Kingfisher Flex Magnetic Particle Processor and MagMAX™-96 DNA Multi-Sample Kit (Thermo Fisher Scientific, Waltham, MA, USA) as per [34 (link)], and was frozen at − 20 °C until use. These blood-stage DNA samples were used to determine qPCR efficiency and the limit of detection (LOD).
DNA was extracted from head/thorax mosquito samples and feeding substrates following the CTAB-based phenol–chloroform extraction method of Chen et al. [35 (link)] with minor modifications (as described in Schneider et al. [33 ]). Extracted DNA was eluted in 30 µl (mosquitoes, supplemented feeding substrates) or 16 µl (mosquito expectorate substrates) of water and frozen at − 20 °C until use. DNA extracts from mosquitoes, but not from feeding substrates, were diluted fourfold to reduce the effect of inhibitors originating from mosquito material on the performance of the PCR. All PCR reactions were run using 7 µl of (diluted) DNA extracts, and data are presented as genomes/PCR, unless stated otherwise, to account for differences in sample processing.

DNA isolation was performed from the whole mosquito body, except of the right wing. Individual specimens were placed into 2 ml tubes and about 10 pieces of 2.0 mm zirconia beads (BioSpec Products, Bartlesville, USA) as well as 1 ml of cell culture medium (high-glucose Dulbecco’s modified Eagle’s medium; Sigma-Aldrich, St. Louis, MO, USA) were added. The homogenization was performed with a Tissuelyser II (Qiagen, Hilden, Germany) for 2 min at 30 oscillations/s and 200 μl of the homogenate were used for DNA extraction, which was performed with KingFisher Flex Magnetic Particle Processor using MagMAX CORE Nucleic Acid Purification Kit (both Thermo Fisher Scientific, Waltham, MA, USA). Polymerase chain reaction (PCR) amplification of cytochrome oxidase subunit I (COI) gene region was conducted with the protocol published by Fang et al.^{32 (link)} using the primers by Folmer et al.³³ . Sanger sequencing was applied for all positive amplicons (LGC Genomics, Berlin, Germany). Furthermore, morphologically identified Cx. pipiens s.l. and An. maculipennis s.l. specimens were typed to species level (Cx. pipiens pipiens form pipiens resp. Anopheles messeae) using two molecular assays^{34 (link),35 (link)}.

Specimens passing pathology review were queued for DNA extraction by lysing cells from formalin-fixed paraffin embedded tissue by digestion with a proteinase K buffer followed by automated purification using the 96-well KingFisher Flex Magnetic Particle Processor (Thermo Fisher Scientific, San Diego, CA) [20 ].

We used a protocol for bacterial DNA extraction that involved mechanical and chemical cell lysis. The stool samples were homogenised by bead beating with acid-washed glass beads (Sigma). We isolated the DNA with an LGC mag nucleic extraction maxi kit (LGC Genomics, Middlesex, UK) together with a KingFisher FLEX magnetic particle processor (ThermoScientific, Waltham, MA) according to the manufacturer’s recommendations, including a negative control as contamination control. Fungal internal transcribed spacer 1 (ITS1) amplicons were constructed using the primer pairs ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2 (GCTGCGTTCTTCATCGATGC), according to Tang et al. [36 (link)]. The fungal ITS quantities in 1516 samples were assessed with a LightCycler qPCR (Roche) of 50 cycles, using thermocycles comprising 95 °C in 15 min, then (95 °C in 30 s, 56 °C in 30 s, 72 °C for 45 s) × 50. For each qPCR plate, we included positive and negative controls (S. cerevisiae and sterile water, respectively). The qPCR cycle threshold (CT) value cut-off for fungal detection was set to either within the value of the negative control or to 45 cycles, because DNA quantification beyond 45 cycles can produce misleading results.