Dneasy column

Genomic DNA was extracted from the posterior retina of five eyes seven days after MSC transplant using DNeasy columns (Qiagen, Valencia, CA). 250 ng of this DNA was used in a quantitative PCR reaction using primers specific for human genomic DNA (forward: GAGAGCGTTTGGAAATTGGA, Reverse: TGGCTGCTGTTTCATGTCTC). Samples were amplified in a quantitative PCR reaction for 45 cycles using a CFX96 thermal cycler (BioRad, Hercules, CA). Data were compared against a standard curve was constructed using genomic DNA extracted from a known quantity of human MSC (17 to 16,750 cells). A positive control containing DNA from 1,675 MSC and a negative control (water only) were included. All measurements were taken in triplicate.

The specimens were collected in the North and South Atlantic Oceans, the southwestern Indian Ocean, and the Southern Ocean. The latter three areas are collectively referred to as the Southern Ocean (Table 1).
Skin samples from free‐ranging baleen whales were collected using remote biopsy sampling techniques (Palsbøll et al., 1991 ). Additionally, some samples were obtained during necropsies from beached carcasses, fisheries bycatches as well as local subsistence or commercial whaling operations prior to the moratorium on commercial whaling in 1986. Tissue samples were preserved in 5 m NaCl with 20% dimethyl sulfoxide (Amos & Hoelzel, 1991 ) and stored at −20 or −80°C. Total‐cell DNA was extracted from tissue samples using either standard phenol and chloroform extraction processes (Sambrook et al., 1989 ) or DNeasy™ columns (Qiagen, Inc.) following the manufacturer's instructions.
Multi‐locus microsatellite genotypes (data not included) were employed to identify and remove duplicate samples collected from the same individual and to identify closely related individuals sampled in a non‐independent manner (e.g., mother and calf). Closely related individuals sampled at random, that is, during different sightings, were retained in the data set (Waples & Anderson, 2017 (link)).

Genomic DNA was extracted using DNeasy columns (Qiagen^®, Hilden, Germany) following the manufacturing instructions. The isolated DNA was quantified using Nanodrop (Thermo Scientific^® Waltham, MA, USA) and biophotometer (Eppendorf^® D30). The quality of DNA was monitored through gel electrophoreses. Complete 16S RNA gene sequencing of selected bacterial strains was done by Sanger method (Institute of Parasitology and Biomedicine “López-Neyra” IPBLN Service). Forward and reverse sequences were provided separately. Reverse sequence was converted to complementary sequence with Chromas Pro 2.0 software (Technelysium Pty Ltd., Tewantin, Australia). Sequences were examined for maximum homology against GenBank using National Center for Biotechnology Information NCBI’s BLASTn program. The collection and comparison of complete 16S rRNA gene sequences were performed using the Ezbiocloud platform [40 (link)].

To measure lentiviral integrations in the host cell genome, we transduced MDA-MB-468 cells (grown in DMEM/10% FBS) with twelve 2 × serial dilutions of CMV-H2b-GFP virus, diluted in M87 medium. After overnight incublation, the medium was refreshed with regular growth medium, DMEM/10% FBS. At 3 days post innoculation, the cells were photographed, dissociated and the GFP⁺ fractions were measured and FACS sorted into either 6, 24, 48 or 96-well dishes (dependent on transduction efficiency per cell yield). After expansion in culture for 1 week, DNA was isolated (DNEasy columns, Qiagen) from cultures derived from dilutions 1–9 (which had accumulated enough cells at that time). Viral integrations in genomic DNA were measured by qPCR using primers specific to the lentiviral GAG sequence (For: 5′- AGG GAG CTA GAA CGA TTC GCA GTT -3′, Rev: 5′- TCT GAT CCT GTC TGA AGG GAT GGT -3′), Lentiviral gene dose was normalized to the single copy gene, albumin42 (link), (FOR: 5′- TGT AGA GAA GTG CTG CAA GGC TGA -3′, REV:5′- TGT CCC ACA TGT ACA AAG CCT CCT -3′). PCR reactions (45 cycles: 95 °C × 15 s, 60 °C × 60 s) were performed in quadruplicate and quantified using the ddCT method; error was propagated using the square root of the sum of squares method and values are expressed as a percentage of albumin.

The resequenced animals used in this study consisted of five dairy goat breeds, including three European dairy goat breeds, namely Saanen dairy goats (N = 25), Toggenburg dairy goats (N = 27), and Alpine dairy goats (N = 16), and two Chinese indigenous dairy goat breeds, Guanzhong dairy goats (N = 19) and Laoshan dairy goats (N = 23). Genomic DNA from these 110 goats was extracted from ear punches (preserved in ethanol, -20 degrees Celsius) using Qiagen DNeasy columns (Qiagen, Hilden, Germany) following the manufacturer’s instructions. The extracted DNA was quantified using a Qubit fluorometer, and the quality was assessed using a Nanodrop spectrophotometer. Sequencing libraries were prepared and barcoded using the TruSeq sample preparation kit. The libraries were sequenced on the Illumina HiSeq X Ten platform using the 150 bp paired-end sequencing strategy.