Anti rxrα

ChIP assays were performed to examine the interactions between TR and TRE on the BSSP4 promoter
[45 (link)]. HepG2-TRα1 cells treated with 10 nM T₃ for 24 h or left untreated were harvested and cross-linked with 1% formaldehyde for 10 min at room temperature in DMEM medium. Reactions were terminated by adding 0.125 M glycine. Subsequently, cell lysates were washed three times with PBS, and resuspended in lysis buffer (150 mM NaCl, 5 mM EDTA, 50 mM Tris (pH 8.0), 0.1% SDS and 0.1% sodium deoxycholate) containing three protease inhibitors (1 mM PMSF, aprotinin, and leupeptin). Cell lysates were sonicated with a Misonix Sonicator 3000 Homogenizer (Mandel Scientific Company Inc., Guelph, ON, Canada) to disrupt chromatin. Sonicated DNA was between 200 and 1000 bp in length. Products were precleared with 60 μl protein A/G agarose (Sigma Chemicals, St. Louis, MO) for 2 h at 4°C. Complexes were immunoprecipitated with anti-TR (kindly provided by the laboratory of Dr. S-Y Cheng at the National Cancer Institute), anti-RXRα (Santa Cruz Biotechnology, Santa Cruz, CA) and anti-IgG antibodies (R & D Systems, Inc., Minneapolis, MN). The 100 bp fragment of the BSSP4 promoter containing the predicted TRE region was amplified via PCR with the forward primer, 5′- CTCCAGGAACGACAGGAGGGCG - 3′, and reverse primer, 5′-GCCTGGGTTTGGAGAGGCTGAAGTC- 3′.

ChIP analysis was performed according to the manufacturer’s instructions (Millipore, Darmstadt, Germany). Briefly, HepG2 cells were crosslinked with 1% formaldehyde for 10 min at room temperature and then quenched with 125 mM glycine. The cells were resuspended and sonicated in SDS lysis buffer. Lysates were incubated overnight at 4 °C with the following antibodies: anti-mouse IgG (Santa Cruz, Dallas, USA), anti-VDR (Santa Cruz) and anti-RXRα (Santa Cruz). Protein G agarose was added to form immunocomplexes, which were washed and subjected to elution. The samples were treated with RNase A and proteinase K. DNA was subsequently purified using PCR purification spin columns (QIAGEN, Hilden, Germany). The primers used to amplify the Immt promoter regions were designated R1 (−3986 to −3203), R2 (−3157 to −2323), R3 (−2312 to −1724), R4 (−1845 to −1159), R5 (−1179 to −550) and R6 (−574 to 115) from the transcription start site (TSS). The primers are listed in Supplementary Table 1.

After isolation, content determination and electrophoresis, proteins were elettroblotted [29 (link)] and incubated with a polyclonal rabbit anti-CRBP-1, anti-RXRα, anti-RARα (1:500, Santa Cruz Biotechnology, USA), anti-RARβ, anti-RARγ, anti-cytokeratin-5/6, anti-cytokeratin-10 (1:500, Abcam, Cambridge, UK), anti-phosphorylated-AKT (pAKT Ser⁴⁷³), anti-AKT, anti-phosphorylated ERK1/2, anti-phosphorylated EGFR (Thr669) and mouse anti-total tubulin antibody (Sigma-Aldrich), followed from horseradish peroxidase conjugate goat anti-rabbit or anti-mouse IgGs (Pierce, Rockford, USA). Specific complexes were revealed and quantified as reported [29 (link)] in three independent experiments. AKT and EGFR activity expressed as phospho/total protein ratio [30 (link)].

Whole-cell lysates were prepared as described previously [4 ], by lysing the cells in boiling buffer (1% SDS, 1 mM sodium vanadate, 10 mM Tris [pH 7.4]) in the presence of complete protease inhibitor mixture (Roche diagnostics). The viscosity of the samples was reduced by sonication. Whole-cell lysates or immunoprecipitation samples were separated by sodium dodecyl sulfate–polyacrylamide gel electrophoresis (SDS-PAGE), and electroblotted onto a nitrocellulose membrane (GE Healthcare). After incubation for one hour at RT with 5% nonfat milk in Tris-buffered saline (TBS)–0.1% Tween-20, membranes were incubated overnight with the primary antibody diluted in TBS-milk-Tween, washed, incubated with the secondary antibody for 30 minutes at RT, and washed again before analysis with a luminol detection kit (Santa Cruz biotechnology) and chemidoc analyser (Bio-Rad, Marnes-la-coquette, France). Relative quantification was performed using ImageLab software. The following mouse mAbs were used: anti–β-actin (A1978) from Sigma-Aldrich, anti- LXRβ (PP-K8917) from R&D sytems. We also used rabbit pAbs anti-RXRα (ΔN197 - Santa Cruz biotechnology) and anti-GFP (PA1-980A – Fisher scientific, Illkirch, France). Secondary Abs HRP-conjugated polyclonal goat anti-mouse and swine anti-rabbit immunoglobulins (Jackson ImmunoResearch, Suffolk, UK) were also used.

Stably transfected MCF-7 and MDA-MB-231 cells or peptide-treated wild type MCF-7 and MDA-MB-231 cells were collected and lysed using an RIPA buffer. The BCA (Pierce kit #23225) method was used for protein quantitation of the whole cell lysates. The whole cell lysates were subjected to SDS-PAGE and Western blotting. Specific proteins were probed using anti-Sin3A (cat#sc-5299, Santa Cruz Biotechnology, Dallas, TX, USA), anti-RARα (cat# sc-515796), anti-RXRα (cat#sc-515929, Santa Cruz Biotechnology, Dallas, TX, USA) and anti-RARβ (cat# sc-56864 Santa Cruz Biotechnology, Dallas, TX, USA), followed by incubation with HR0 conjugated anti-mouse antibodies (cat# 7076, Cell Signaling technologies, Denvers, MA, USA). The bands were visualized by chemiluminescence.