Abi 7500 sequence detector system

Total RNA from HEL cells treated with metfomin (10 mM) and/or ruxolitinib (300 nM) was obtained using TRIzol reagent (Thermo Fisher Scientific). The cDNA was synthesized from 1 µg of RNA using High-Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific). PCR array was performed using the PI3K-AKT Signaling Pathway RT² Profiler PCR Array kit (#PAHS-058A; SA Biosciences, Frederick, MD, USA) according to the manufacturer’s instructions. mRNA levels were normalized to those detected in untreated cells, and genes that presented a fold change ≥1.5-fold in any treatment were included in the heatmap using Heatmap builder software (The Ashley Lab, Stanford University, CA, USA). Amplification was performed in an ABI 7500 Sequence Detector System (Life technologies).

Total RNA was isolated from the septal nasal mucosa using TRIzol reagent (Life Technologies, Gaithersburg, MD, United States) on day 40 and then converted to cDNA using the ReverTra Ace qPCR RT Master Mix with gDNA Remover (Toyobo, Osaka, Japan) according to the manufacturer’s instructions. qPCR analysis was performed using the THUNDERBIRD Probe qPCR Mix or THUNDERBIRD SYBR qPCR Mix (Toyobo) and an ABI 7500 sequence detector system (Life Technologies). The gene-specific primers and probes used were: Rps3 as endogenous control (Life Technologies assay number Mm00656272_m1), interleukin 1 beta (Il1b) (forward 5′-AAATACCTGTGGCCTTGGGC-3′, reverse 5′-TCT TCTTTGGGTATTGCTTGGGA-3′), tumor necrosis factor-alfa (Tnfa) (forward 5′-GTAGCCCACGTCGTAGCAAA-3′, reverse 5′-TTGAGATCCATGCCGTTGGC-3′), Il4 (forward 5′-TCGGC ATTTTGAACGAGGTC-3′, reverse 5′-CTGTGGTGTTCTTCG TTGCTG-3′), Il5 (forward 5′-TTGACCGCCAAAAAGAGAA GTG-3′, reverse 5′-CTCAGCCTCAGCCTTCCATT-3′), Il13 (forward 5′-AGCATGGTATGGAGTGTGGAC-3′, reverse 5′-GC TGGAGACCGTAGTGGGG-3′), Il17 (forward 5′-GGACTCTC CACCGCAATGAA-3′, reverse 5′-TTTCCCTCCGCATTGACA CA-3′), Il25 (forward 5′-TGGAGCTCTGCATCTGTGTC-3′, reverse 5′-GATTCAAGTCCCTGTCCAACTC-3′), and Il33 (forward 5′-GGTGAACATGAGTCCCATCA-3′, reverse 5′- CGTCACCCCTTTGAAGCTC -3′). The expression levels of each gene were normalized to the level of Rps3 expression for each sample.

Total RNA was obtained using TRIzol reagent (Thermo Fisher Scientific). The cDNA was synthesized from 1 µg of RNA using High-Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific). Quantitative PCR (qPCR) was performed with an ABI 7500 Sequence Detector System using the TaqMan system for AURKA (Hs00269212.m1), AURKB (Hs00177782.m1), ATCB (4310881E-1008027), and GUS (43108881E-0905024) genes (Life Technologies) or SyberGreen System for AURKA, AURKB, BCL2, BCL2L1, BIRC5, BNIP3, BNIP3L, and BIK (Supplementary Table 3). ATCB, GUS, and/or HPRT1 were the reference genes. The relative quantification value was calculated using the equation 2^−ΔΔCT. A negative ‘No Template Control’ was included for each primer pair.

Lung tissues of different groups mice were frozen in TRIzolsolution (Invitrogen, Carlsbad, CA, United States). According to the protocol of TRIzol, total RNA was isolated and transcribed to cDNA using the RevertAid^TM First Strand cDNA Synthesis Kit (Fermentas, Glen Burnie, MD, United States). The primer sequences were as follows: for REST,
SYBR Green I was used to perform quantitative real-time PCR on an ABI 7500 sequence detector system (Applied Biosystems). Target gene expression was normalized to β-actin using the 2^-ΔΔCT method.

TaqMan PCRs for the detection of C. trachomatis, N. gonorrhoeae, Ureaplasma spp. and Mycoplasma spp. [9 ] and Trichomonas vaginalis [11 (link)], with detection limits of 25 genome copies per reaction, were carried out on a CFX96 Real time PCR machine (Biorad, Munich, Germany) in a total volume of 25μl containing 2.5μl DNA-solution of the swab specimens in NoROX PCR Mastermix (Qiagen, Hilden, Germany) with primers and probes concentrations as published. Fifty copies of an internal control (IC) plasmid were added as an inhibition control [9 ]. Thermal cycling conditions were as follows: 10min at 95°C for initial denaturation followed by 45 cycles of 95°C for 15s and 60°C for 1min. HSV-2- and CMV-PCRs with detection limits each of 5 copies per reaction were performed with an ABI 7500 sequence detector system (Applied Biosystems, Darmstadt, Germany) as described before [10 (link)]. BlastN search of primers and probes showed no homology with other known STI pathogens, and clinical samples positive for other human herpesviruses and STI pathogens no cross reaction, too.

Quantitative PCR (qPCR) was performed with an ABI 7500 Sequence Detector System (Applied Biosystems, Foster City, CA, USA) with specific primers for Stathmin 1 (forward: AGCCCTCGGTCAAAAGAATC; reverse: TTCAAGACCTCAGCTTCATGGG) [38 (link)] and HPRT (hypoxanthine phosphoribosyltransferase 1; forward: GAACGTCTTGCTCGAGATGTGA; reverse: TCCAGCAGGTCAGCAAAGAAT). The relative quantification value was calculated using the equation 2^−ΔΔCT [39 (link)]. A negative ‘No Template Control’ was included for each primer pair. The dissociation protocol was performed at the end of each run to check for non-specific amplification. Three replicas were run on the same plate for each sample.