Total RNA in MDA-MB-231 and MDA-MB-468 cells was extracted using TRIzol® reagent (Invitrogen; Thermo Fisher Scientific, Inc.). RNA was reverse transcribed to cDNA using the Reverse transcription system kit (Promega Corporation; cat. no. A3500), according to the manufacturer's instructions. qPCR analysis was performed using SYBR Master Mixture (Takara Bio, Inc.) on the Agilent MX3000p Real Time PCR system (Agilent Technologies, Inc.) as follows: 1 cycle at 95°C for 30 sec; 40 cycles at 95°C for 5 sec and 60°C for 20 sec; 1 cycle at 65°C for 15 sec. qPCR primers were as follows: SOX9 forward, 5′-AGCGAACGCACATCAAGAC-3′ and reverse, 5′-CTGTAGGCGATCTGTTGGGG-3′; and GAPDH forward, 5′-TGACTTCAACAGCGACACCCA-3′ and reverse, 5′-CACCCTGTTGCTGTAGCCAAA-3′. mRNA expression was analyzed using the 2−ΔΔCq method (14 (link)).
Agilent mx3000p real time pcr system
Manufactured by Agilent Technologies
Sourced in United States
The Agilent Mx3000P Real-Time PCR System is a laboratory instrument designed for quantitative real-time polymerase chain reaction (qRT-PCR) analysis. It provides precise detection and quantification of DNA and RNA targets.
Automatically generated - may contain errors
Lab products found in correlation
Primescript rt reagent kit, by Takara Bio (2 mentions)
Revertaid first strand cdna synthesis kit, by Thermo Fisher Scientific (2 mentions)
Sybr master mixture, by Takara Bio (1 mentions)
Reverse transcription system kit, by Promega (1 mentions)
Trizol reagent, by Thermo Fisher Scientific (1 mentions)
Sybr primescript plus rt pcr kit, by Takara Bio (1 mentions)
Rnaiso plus, by Takara Bio (1 mentions)
Qrt pcr, by Thermo Fisher Scientific (1 mentions)
Superscript 2 first strand synthesis system, by Thermo Fisher Scientific (1 mentions)
Sybr pcr master mix, by Takara Bio (1 mentions)
Tri reagent, by Merck Group (1 mentions)
Transstart tip green qpcr supermix, by Transgene (1 mentions)
Rnapure high purity total rna rapid extraction kit, by BioTeke (1 mentions)
Easyscript all in one first strand cdna synthesis kit, by Transgene (1 mentions)
Sybr green pcr master mix, by Bio-Rad (1 mentions)
Trizol, by Molecular Research Center (1 mentions)
Tb green premix ex taqtm, by Takara Bio (1 mentions)
Trizol reagent, by Takara Bio (1 mentions)
Reverse transcription reagent kit, by Takara Bio (1 mentions)
8 protocols using agilent mx3000p real time pcr system
1
Quantifying SOX9 mRNA expression in breast cancer cells
2
BNIP3 Expression Quantification by qRT-PCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The RNAiso Plus (Takara Bio, 9108) was used to extract total RNA and the subsequential reverse transcription was conducted with a PrimeScript™ RT reagent Kit (Takara Bio, RR047A). The resulting cDNAs or DNAs were quantified using real-time PCR with a SYBR PrimeScript PLUS RT-PCR Kit (Takara Bio, RR096A) on the Agilent Mx3000P Real-Time PCR System (Agilent Technologies, Santa Clara, CA, USA), using the following primers: BNIP3 forward primer, 5′-ACCACAAGATACCAACAGAG-3′; BNIP3 reverse primer, 5′-AGAGCAGCAGAGATGGAA-3′; β-actin forward primer, 5′-CTGTGCTATGTTGCCCTGGACTTC-3′; β-actin reverse primer, 5′-GCTCGTTGCCGATGGTGATGAC-3′. The relative expression was calculated using the 2-ΔΔCT method.
3
Quantitative RT-PCR Analysis of RAR Genes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
We synthesized cDNA from 1 μg of total RNA using the RevertAid First Strand cDNA Synthesis Kit (Thermo, Inc). We performed quantitative RT-PCR (q-PCR) using SYBR Green PCR master mix on an Agilent Mx3000P Real Time PCR system (Agilent, Inc). We used the following human primer sequences: RARβ2 forward 5′-3′ GCTCCAGGAGAAAGCTCTCAAAG and reverse 5′-3′ ATTTGTCCTGGCAGACGAAGC; RARβ forward 5′-3′ ATGACAGCTGAGTTGGACGA and reverse 5′-3′ GTCAGCACTGGAATTCGTGG; HPRT forward 5′-3′ TGCTCGAGATGTGATGAAGG and reverse 5′-3′ TCCCCTGTTGACTGGTCATT.
4
Quantifying Gene Expression in MCF-7 Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from the harvested MCF-7 cells according to the manufacturer’s instructions using TRI reagent (Sigma). The concentration of RNA was determined by measuring OD at . First-strand complementary DNA (cDNA) was synthesized with the SuperScript II First-Strand Synthesis System for quantitative reverse transcription–polymerase chain reaction (qRT-PCR; Invitrogen). qPCR amplification was carried out using actin as an endogenous control. SYBR Green probes for each gene were used. The primers are listed in Table S2. Real-time PCR was carried out using of cDNA and SYBR PCR master mix (TaKaRa) in the Agilent Mx3000P Real-time PCR System with the two-step procedure (95°C 2 min, 1 cycle; 95°C 15 s, 60°C 1 min, 30 cycles). Relative quantitation of each single gene expression was performed using the comparative threshold cycle method.
5
Rapid RNA Extraction and Real-Time PCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA from cells and tissues was extracted using RNApure High-purity Total RNA Rapid Extraction Kit (#RP1202, BioTeke Corporation, China) and then 1.0 μg RNA was reversely transcribed into cDNA using EasyScript All-in-One First-Strand cDNA Synthesis Kit (#AE341-03, TransGen Biotech, China). cDNA was amplified via real-time PCR using TransStart Tip Green qPCR SuperMix (#AQ141-04, TransGen Biotech, China) on the Agilent Mx3000P Real-Time PCR System (Agilent Technologies, USA). The primer details were provided in Additional file 1: Table S3.
6
Quantifying mRNA Levels via qPCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was prepared from hNECs by using of TRIzol (Molecular Research Center Inc.) and cDNA conversion was conducted by virtue of Superfast M‐MLV1 reverse transcriptase (Bioswamp). qPCR was performed using SYBR® Green PCR master mix (Bio‐Rad Laboratories, Inc.) in the Agilent MX3000p Real‐Time PCR system (Agilent Technologies, Inc.) as per the manufacturer's protocol under the following conditions: denaturation at 95°C for 5min, followed by 40 cycles of 95°C for 10 s and 60°C for 30 s. The alternations in relative messenger RNA (mRNA) levels were determined using the 2‐∆∆Cq method.27 GAPDH was employed to normalize the relative mRNA levels.
7
qRT-PCR Analysis of Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
TRIzol reagent (9108, Takara, Japan) was used to extract total RNA, and then, we used a Prime Script RT Reagent Kit (RR037A, Takara, Japan) to perform reverse transcription. The Agilent Mx3000P Real‐Time PCR System (Agilent Technologies, Santa Clara, CA, USA) was used to perform qRT‐PCR with TB GreenTM Premix Ex TaqTM (RR420A, Takara, Japan), and the 2‐△△Ct method (Ct values are threshold cycles) was performed to calculate the relative mRNA levels. All samples were normalized to glyceraldehyde‐3‐phosphate dehydrogenase (GAPDH), which was used as an internal reference gene. Experiments were independently repeated at least three times. Primers used in the qRT‐PCR assay are listed in Table S2 .
8
Quantifying Gene Expression Changes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA was extracted using RNAiso Plus in accordance with the manufacturer's instructions and reverse transcribed into cDNA using a reverse transcription reagent kit, according to the manufacturer's protocol (both from Takara Biotechnology Co., Ltd., Dalian, China). The RT-PCR reactions were prepared using a PCR kit (Takara Biotechnology Co., Ltd.) and performed on an Agilent Mx3000P™ Real-Time PCR System (Stratagene). The primers used were synthesized by Invitrogen (Invitrogen; Thermo Fisher Scientific, Inc.), and the sequences were as follows: ACSS2 primers, 5′-GGATTCCAGCTGCAGTCTTC-3′ (forward) and 5′-CAGCCAGCTCCTTCAGGTT-3′ (reverse); PCNA primers, 5′-CTGAAGCCGAAACCAGCTAGACT-3′ (forward) and 5′-TCGTTGATGAGGTCCTTGAGTGC-3′ (reverse); β-actin primers, 5′-TCACCCACACTGTGCCCATCTACGA-3′ (forward) and 5′-CAGCGGAACCGCTCATTGCCAATGG-3′ (reverse). Relative expression levels were calculated using the 2-ΔΔCq method (38) (link) and β-actin was used as an internal reference gene.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!