Lentivirus packing shrna expression vector

The sequence of the DUB3 siRNA was 5′-GAAAUUCCUUCAAGAGCAA-3′). The sequence of control siRNA was 5′-TTCTCCGAACGTGTCACGTTTC-3. These siRNAs were synthesized by Shanghai GenePharma (Shanghai, China). Transfection was carried out according to the manufacturer’s protocol. After 48 h, cells were washed with PBS, lysed directly with M-PER lysis buffer and protein levels were assessed by Western blot analysis. To stably knock down endogenous DUB3 expression in some case, we used lentivirus packing shRNA expression vector (purchased from Shanghai GenePharma) to infect cells. Target cells were infected with lentivirus for 24–48 h according to manufacturer’s instruction. The DUB3 shRNA target sequence was 5′-GCAGGAAGATGCCCATGAATT-3′. The control shRNA sequence was 5′-TTCTCCGAACGTGTCACGT-3′.

Pre-designed STIP siRNA duplexes (sense sequence: 5′-CCUGUUAAGCAGGACGACUtt-3′) and negative control siRNAs were from Ambion. Cells were reverse-transfected with STIP or control siRNAs as specified by the manufacturer. To stably knock down endogenous STIP or USP7 expression in some case, we used lentivirus packing shRNA expression vector (purchased from GenePharma, Shanghai, China) to infect cells. Target cells were infected with lentivirus for 24–48 h according to manufacturer's instruction. STIP shRNA target sequences were: STIP shRNA#1, 5′-TGGGTTGGAAGTCGATGTT-3′; STP shRNA#2, 5′-GTGGATCTTAGATAACATA-3′. USP7 shRNA target sequence was: 5′-AGTCGTTCAGTCGTCGTAT-3′.

Pre‐designed STIP siRNA duplexes (sense sequence: 5′‐TGGGTTGGAAGTCGATGTT‐3′) and negative control siRNAs (5′‐TTCTCCGAACGTGTCACGTTTC‐3′) were purchased from GenePharma (Shanghai, China). A549 and H460 cells were transfected with STIP or control siRNA by Genmute transfection reagent (SignaGen, Gaithersburg, MD, USA) following the manufacturer's instruction. To stably knockdown endogenous STIP in some case, we used lentivirus packing shRNA expression vector (purchased from GenePharma) to infect A549 and H460 cells. Sip1/tuftelin‐interacting protein shRNA target sequences were 5′‐GTGGATCTTAGATAACATA‐3′. The control shRNA sequence was 5′‐TTCTCCGAACGTGTCACGTTTC‐3′.