The total RNA was isolated from the treated cardiomyocytes using the Trizol reagents (Thermo, Massachusetts, USA). The extracted RNA was treated with DNase I (Thermo, Massachusetts, USA) for 10 min to remove contaminated cDNA. The quality and concentration of RNA were validated using a Nanodrop 2000 spectrophotometer (Thermo, Massachusetts, USA). The wavelength absorption ratio (260/280 nm) was between 1.8 and 2.0 for all preparations. A total 1 µg of RNA was transcribed into cDNA utilizing the Reliance Select cDNA Synthesis Kit (Bio-Rad, California, USA). In the present study, the PCR reaction was conducted utilizing the SYBR Master Mix kit with a 25-μL reaction system and the StepOne-Plus system (Takara, Tokyo, Japan) according to the following procedure: denaturing at 95 °C for 30 s, annealing at 60 °C for 1 min and extending at 95 °C for 5 s for 40 cycles, and 72 °C 10 min, 1 cycle. Finally, the 2−ΔΔCt method was used to determine the relative expression level of target genes with β-actin used for normalization. The following primers were used in this study: p21, (F: 5′ -TGTTCCACACAGGAGCAAAG-3′, R: 5′-AACACGCTCCCAGACGTAGT-3′), β-actin (F: 5′-CTGCCCTGGCTCCTAGCAC-3′, R: 5′- CGGACGCAGCTCAGTAACAGTCCG-3′).
Steponeplus system
Manufactured by Takara Bio
Sourced in Japan
The StepOnePlus™ system is a real-time PCR instrument designed for quantitative gene expression analysis. It is capable of performing real-time PCR reactions and provides data collection and analysis capabilities.
Automatically generated - may contain errors
Lab products found in correlation
Trizol reagent, by Thermo Fisher Scientific (11 mentions)
Primescript rt reagent kit, by Takara Bio (4 mentions)
Steponeplus real time pcr system, by Thermo Fisher Scientific (4 mentions)
Rnaiso plus, by Takara Bio (3 mentions)
Sybr green rt pcr, by Takara Bio (3 mentions)
Sybr master mix kit, by Takara Bio (2 mentions)
Nanodrop 2000 spectrophotometer, by Thermo Fisher Scientific (2 mentions)
Dnase 1, by Thermo Fisher Scientific (2 mentions)
Reliance select cdna synthesis kit, by Bio-Rad (1 mentions)
Sybr green, by Takara Bio (1 mentions)
Mircute plus mirna first strand cdna kit, by Tiangen Biotech (1 mentions)
Sybr green premix ex taq, by Takara Bio (1 mentions)
First strand cdna synthesis kit, by Toyobo (1 mentions)
Sybr green 2, by Takara Bio (1 mentions)
Tb green kit, by Takara Bio (1 mentions)
Primescript rt master mix kit, by Takara Bio (1 mentions)
Sybr green premix kit, by Takara Bio (1 mentions)
Primescript rt master mix perfect, by Takara Bio (1 mentions)
Sybr master mix, by Takara Bio (1 mentions)
Rt master mix, by Takara Bio (1 mentions)
13 protocols using steponeplus system
1
Quantitative Analysis of p21 Gene Expression
2
Quantitative Gene Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was exacted from thoracic aorta and VSMCs with a Trizol reagent (Life Technologies, Gaithersburg, MD, USA). Then, 1 μg total RNA was reversed to cDNA using the PrimeScript® RT reagent Kits (Takara, Otsu, Shiga, Japan) and StepOnePlus™ Real-Time PCR System (Applied Biosystems, Foster City, CA, USA). The quantitative reactions were made with SYBR Green (Takara Biotechnology Co., Ltd., Tokyo, Japan) by StepOnePlus™ system. GAPDH was used as the internal control. All primers used for qRT-PCR are listed in a table (Table S1 ).
3
Quantitative Gene Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Tissue or cultured cells were lysed using RNAiso plus (Takara, Japan), and total RNA was extracted according to the manufacturer’s instructions. cDNA was synthesized using kit RR036 according to the manufacturer’s instructions (Takara, Japan). qPCR was performed on StepOnePlus™ system using kit RR820 according to the manufacturer’s instructions (Takara, Japan). The following primers were used: human B7-H1 forward: TGGCATTTGCTGAACGCATTT, reverse: TGCAGCCAGGTCTAATTGTTTT; human glyceraldehyde-3-phosphate dehydrogenase (GAPDH) forward: CTGGGCTACACTGAGCACC, reverse: AAGTGGTCGTTGAGGGCAATG; human HDAC1 forward: CTACTACGACGGGGATGTTGG, reverse: GAGTCATGCGGATTCGGTGAG; human HDAC2 forward: ATGGCGTACAGTCAAGGAGG, reverse: TGCGGATTCTATGAGGCTTCA; human HDAC3 forward: CCTGGCATTGACCCATAGCC, reverse: CTCTTGGTGAAGCCTTGCATA; and human JAK2 forward: TCTGGGGAGTATGTTGCAGAA, reverse: AGACATGGTTGGGTGGATACC.
4
Quantification of mRNA and miRNA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from cells or tissues using TRIzol reagent (Invitrogen, CA, USA), and 1 μg of RNA was reverse-transcribed for mRNA and miRNA analyses using a first strand cDNA synthesis kit (TOYOBO, Osaka, Japan) and miRcute Plus miRNA first-strand cDNA kit (Tiangen, Beijing, China), respectively. The qPCR program was performed with ABI StepOne Plus system using SYBR Green Premix Ex Taq (Takara, Tokyo, Japan). The primers used to detect mRNAs and miRNAs are listed in table S6. The relative expression levels of mRNAs or miRNAs were determined using the 2−ΔΔCT method after normalization to β-actin or U6, respectively, as the loading control. All experiments included biological and technical replicates.
5
Mulberry Transcriptional Response to Flooding
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated from mulberry roots, barks, leaves, male flowers, female flowers, and fruits using RNAiso Plus (Takara, Japan) according to the manufacturer’s instructions. The quality and concentration of RNA samples were measured using a ND-1000 UV spectrophometer (Nanodrop Technologies, USA). Reverse transcription was performed following the manufacturer’s instructions (Takara, Japan). Primers were designed using Primer Premier 5 software (http://www.primer-e.com/ ). Polymerase chain reactions were performed in a 96-well plate with a StepOne Plus System apparatus, amplified with SYBR® Green II (Takara, Japan) according to the manufacturer’s instructions. Cycling conditions were as follows: 90 °C for 30 s; 40 cycles of 95 °C for 5 s and 60 °C for 30 s. Amplification specificity was verified by a dissociation curve. To compare data from different PCR runs, cycle threshold (CT) values for samples were normalized to that of the mulberry ribosomal protein gene (Morus024083). The cDNA quantity was calculated using ; here, ΔCT is the difference in the number of cycles between tests and controls. The change in gene expression after flooding treatment was measured using , where ΔΔCT = (ΔCT sample − ΔCT control). Gene-specific primers used for the real-time RT-PCR are listed in Supplementary Table 2 . All results are representative of three independent experiments.
6
Comprehensive RNA Extraction and qRT-PCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from human tissues, mouse tissues and cells with TRIzol reagent (Life Technologies, Gaithersburg, MD, USA). Reverse transcription experiments were performed with PrimeScript® RT reagent Kits (Takara, Otsu, Shiga, Japan) and a StepOnePlus™ Real-Time PCR System (Applied Biosystems, Foster City, CA, USA). Next, quantitative reactions were performed with SYBR Green RT-PCR (Takara Biotechnology Co., Ltd., Tokyo, Japan) using the StepOnePlus™ system. GAPDH and U6 snRNA were used as the internal controls.
7
Quantitative RT-PCR for Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted using RNAiso Plus (Takara, Shiga, Japan) and cDNA was synthesized with PrimeScript RT Master Mix Kit (Takara, Japan). RT-PCR was performed with TB-Green Kit (Takara, Japan) on StepOnePlus system (USA). The primer sequences are shown in Supplementary Table 1 . Relative mRNA level was analyzed by 2−ΔΔCT method.
8
Quantitative Analysis of Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated from the cells using TRIzol® Reagent (Invitrogen; Thermo Fisher Scientific, Inc.). The mRNAs were reverse-transcribed to cDNAs using a PrimeScript® RT Master mix (Perfect Real Time; Takara Bio, Inc.) under the reaction conditions of 37°C for 15 min and 85°C for 5 sec. RT-qPCR was performed using an Applied Biosystems StepOnePlus™ system using a SYBR Green Premix kit (Takara Bio Inc.) as the fluorophore. Primers were as follows: Cyclin D1 forward, 5′-TCTACACCGACAACTCCATCCG-3 and reverse, 5′-TCTGGCATTTTGGAGAGGAAGTG-3; STAT3 forward, 5′-CCCATCCAGGCTGAGTATGT-3 and reverse, 5′-GATCCAGTCCGTGGAACCAT-3; JAK2 forward, 5′-CCTTGTACTTCACGATGTTGTC-3 and reverse, 5′-GTGGAGATGTGCCGCTATG-3; NF-κB p65 forward, 5′-CTTCAGAATGGCAGAAGATGA-3 and reverse, 5′-CACATACATAACGGAAACGAAA-3; β-actin forward, 5′-TCACCCACACTGTGCCCATCTACGA-3 and reverse, 5′-CAGCGGAACCGCTCATTGCCAATGG-3. The thermocycling conditions were: i) 95°C For 10 min; and ii) 40 cycles of 95°C for 30 sec, 58°C for 30 sec and 72°C for 30 sec. The mRNA levels of cyclin D1, STAT3, JAK2, and NF-κB p65 were normalized to those of β-actin. The results were analyzed using the 2−∆∆Cq method (27 (link)).
9
Quantifying gene expression in astrocytes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The Trizol reagent (Thermo, Massachusetts,
USA) was used to extract total RNA from the astrocytes, which was
reverse-transcribed to cDNA with RT Master Mix (Takara, Tokyo, Japan).
Real-time polymerase chain reaction (PCR) was conducted with the SYBR
Master Mix utilizing the StepOne-Plus system (Takara, Tokyo, Japan)
by denaturing at 95 °C for 30 s, annealing at 60 °C for
1 min, and extending at 95 °C for 5 s. The relative expressions
of genes were evaluated using the 2-△△Ct method, with GADPH as the internal negative control. The following
primers were used in this study: IL-6 (F: 5′-AACAGCGATGATGCAC-3′,
R: 5′-TGGGGTAGGAAG GACT-3′); BDNF (F: 5′-TCAGCAGTCAAGTGCCTTTGG
-3′, R: 5′-CGCCGAACCCTCATAGACATG -3′); iNOS (F:
5′-CGAAACGCTTCACTTCCAA -3′, R: 5′-TGAGCCTATATTGCTGTGGCT-3′);
MCP-1 (F: 5′-GCATCCACGTGTTGGCTCA-3′, R: 5′-CTCCAGCCTACTCATTGGGATCA-3′);
COX-2 (F: 5′-CAGACAACATAAACTGCGCCTT -3′, R: 5′-GATACACCTCTCCACCAATGACC
-3′); GAPDH (F: 5′-CCGTGAAAAGAT GACCCAG-3′, R:
5′-TAGCCACGCTCGGTC AGG-3′).
USA) was used to extract total RNA from the astrocytes, which was
reverse-transcribed to cDNA with RT Master Mix (Takara, Tokyo, Japan).
Real-time polymerase chain reaction (PCR) was conducted with the SYBR
Master Mix utilizing the StepOne-Plus system (Takara, Tokyo, Japan)
by denaturing at 95 °C for 30 s, annealing at 60 °C for
1 min, and extending at 95 °C for 5 s. The relative expressions
of genes were evaluated using the 2-△△Ct method, with GADPH as the internal negative control. The following
primers were used in this study: IL-6 (F: 5′-AACAGCGATGATGCAC-3′,
R: 5′-TGGGGTAGGAAG GACT-3′); BDNF (F: 5′-TCAGCAGTCAAGTGCCTTTGG
-3′, R: 5′-CGCCGAACCCTCATAGACATG -3′); iNOS (F:
5′-CGAAACGCTTCACTTCCAA -3′, R: 5′-TGAGCCTATATTGCTGTGGCT-3′);
MCP-1 (F: 5′-GCATCCACGTGTTGGCTCA-3′, R: 5′-CTCCAGCCTACTCATTGGGATCA-3′);
COX-2 (F: 5′-CAGACAACATAAACTGCGCCTT -3′, R: 5′-GATACACCTCTCCACCAATGACC
-3′); GAPDH (F: 5′-CCGTGAAAAGAT GACCCAG-3′, R:
5′-TAGCCACGCTCGGTC AGG-3′).
10
Quantitative gene expression analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The trizol reagents
(Thermo Fisher Scientific, MA) were used to isolate the total RNA
from the treated bEnd.3 brain endothelial cells, which were reverse-transcribed
to cDNA using the RT Master Mix kit (Takara, Tokyo, Japan). The SYBR
Master Mix kit (Takara, Tokyo, Japan) with the StepOne-Plus system
(Takara, Tokyo, Japan) was used to perform the PCR by denaturing at
95 °C for 30 s, annealing at 60 °C for 1 min, and extending
at 95 °C for 5 s. The relative gene expressions of related proteins
were quantified using the 2–ΔΔCt method,
with glyceraldehyde 3-phosphate dehydrogenase (GAPDH) as the internal
negative control.
(Thermo Fisher Scientific, MA) were used to isolate the total RNA
from the treated bEnd.3 brain endothelial cells, which were reverse-transcribed
to cDNA using the RT Master Mix kit (Takara, Tokyo, Japan). The SYBR
Master Mix kit (Takara, Tokyo, Japan) with the StepOne-Plus system
(Takara, Tokyo, Japan) was used to perform the PCR by denaturing at
95 °C for 30 s, annealing at 60 °C for 1 min, and extending
at 95 °C for 5 s. The relative gene expressions of related proteins
were quantified using the 2–ΔΔCt method,
with glyceraldehyde 3-phosphate dehydrogenase (GAPDH) as the internal
negative control.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!