Log In Sign up
The largest database of trusted experimental protocols

Abi prism 7000

Manufactured by PerkinElmer
Visit Supplier
Sourced in United States

The ABI Prism 7000 is a real-time PCR system designed for gene expression analysis and quantification. It features a 96-well format and supports multiple fluorescent dye chemistries for detection.

Automatically generated - may contain errors

Lab products found in correlation

Kod syber qpcr mix, by Toyobo (3 mentions) Superscript 2, by Thermo Fisher Scientific (2 mentions) Primescript 2 1st strand cdna synthesis kit, by Takara Bio (1 mentions) Isogen 2, by Fujifilm (1 mentions) Kod sybr qpcr mix, by Toyobo (1 mentions) Sybr green master mix, by Thermo Fisher Scientific (1 mentions) Primer express software, by PerkinElmer (1 mentions) Dnase 1, by Promega (1 mentions) Ex taq polymerase, by Takara Bio (1 mentions) Primescript rt master mix, by Takara Bio (1 mentions) Primestar hs dna polymerase, by Takara Bio (1 mentions) Isogen 2, by Nippon Gene (1 mentions) Dnase 1, by Thermo Fisher Scientific (1 mentions) Sybr green pcr master mix, by Thermo Fisher Scientific (1 mentions) Rneasy lipid tissue mini kit, by Qiagen (1 mentions) Power sybr green master mix, by Thermo Fisher Scientific (1 mentions) Taqman gene expression assay, by Thermo Fisher Scientific (1 mentions)

8 protocols using abi prism 7000

1

Real-Time PCR Analysis of Bcl-xL Expression

Cited 1 time
Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA from HeLa cells (2 × 105 cells) was extracted by ISOGEN II (WAKO) as described in the instruction manual. First-strand cDNA synthesis was performed with a PrimeScript™ II 1st strand cDNA Synthesis Kit (Takara Bio). Real-time quantitative PCR (qPCR) analysis was conducted using KOD SYBR qPCR Mix (TOYOBO) with the fluorescent dye SYBR Green and a ABI Prism 7000 (PerkinElmer Life Sciences) for detection. Primer pairs for the Bcl-xL gene PCR were synthesized according to the previous report59 (link). The PCR protocol was performed as described in the instruction manual. The reaction mixture was activated at 98 °C for 2 min of 1 cycle, followed by denaturation for 10 s at 98 °C, annealing for 10 secs at 60 °C and extension for 30 s at 68 °C, for 45 cycles. The dissociation curve for each sample was analyzed to verify the specificity of each reaction. The relative mRNA expression levels of Bcl-xL genes were determined by the delta-delta Ct method and normalized to β-actin expression. Specific primers were as follows: sense; 5′-TTCTACAATGAGCTGCGTGTG-3′ and antisense 5′-GGGGTGTTGAAGGTCTCAAA-3′.
Yahiro K., Nagasawa S., Ichimura K., Takeuchi H., Ogura K., Tsutsuki H., Shimizu T., Iyoda S., Ohnishi M., Iwase H., Moss J, & Noda M. (2018). Mechanism of inhibition of Shiga-toxigenic Escherichia coli SubAB cytotoxicity by steroids and diacylglycerol analogues. Cell Death Discovery, 4, 22.
+ Open protocol
+ Expand
2

Bone RNA Extraction and qPCR Analysis

Cited 1 time
Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA was extracted using a TRI-Reagent kit as per the manufacturer’s instructions. For total bone RNA extraction, humeri were homogenized using an Ultra Turrax homogenizer and samples were then processed as per the TRI-Reagent extraction protocol. Two micrograms of total RNA, digested with DNAse I (Promega), were subjected to reverse transcription-polymerase chain reaction (RT-PCR) analysis as previously described (20 (link)). Quantitative PCR assays were run using an ABI Prism 7,000 real-time PCR machine (PerkinElmer Life and Analytical Sciences). The final reaction volume was 20 μl, including 100 nM of specific primers, 20 ng of reverse-transcribed RNA, and 10 μl of SYBR Green master mix (Applied Biosystems). Quantitative PCR conditions were as follows: 2 min at 50°C; 10 min at 95°C; and 40 cycles of 15 s at 95°C, 1 min at 60°C. The expression of genes was normalized to the expression of two housekeeping genes, 36B4 and hprt. Gene expression was quantified using the comparative −ΔCt method. The oligonucleotides for each target of interest, designed using Primer Express software (PerkinElmer Life and Analytical Sciences), are shown (forward and reverse) in Table 1.
Beranger G.E., Djedaini M., Battaglia S., Roux C.H., Scheideler M., Heymann D., Amri E.Z, & Pisani D.F. (2015). Oxytocin Reverses Osteoporosis in a Sex-Dependent Manner. Frontiers in Endocrinology, 6, 81.
+ Open protocol
+ Expand
3

Quantitative RNA Expression Analysis in Hepatocytes

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA from Hepatocytes (3 × 105 cells/12-well plate) was extracted and cDNA synthesised as described above. Real-time quantitative PCR (qPCR) analysis was used with KOD SYBER qPCR Mix (TOYOBO) and ABI Prism 7000 (PerkinElmer Life Sciences). Primers used for PCR were as follows: PHB1, 5’-GCGTGGTGAACTCTGC CTTA-3’ (forward) and 5’-TGTACCCACGGGATGAGAAA-3’ (reverse), PHB2, 5’-CCGAGGGCCTTCACTTCA-3’ (forward) and 5’-CCTGTA GGGGAGGAGATTTTTC-3’ (reverse), β-actin, 5’-CGG CATCGTCAC CAACTG-3’ (forward) and 5’-GGCACACGCAGCTCATTG-3’(reverse) (Soulitzis et al., 2012 (link)). The PCR protocol was performed as described in the instruction manual. The dissociation curve for each sample was analysed to verify the specificity of each reaction. The relative mRNA expression levels of PHB1 and PBH2 genes were determined by the delta–delta Ct method and normalised to actin expression. RT-PCR analysis was used with ExTaq polymerase (Takara). The PCR conditions were as follows: 35 cycles of 98°C for 10 s, 55°C for 15 s, and 72°C for 30 s. Primers used for PCR were as follows: LRP1, 5’- CAACGGCATCTCAGTGGACTAC-3’ (forward) and 5’-TGTTGCTGGACAGAACCACCTC-3’ (reverse), β-actin, 5’-CGGCAT CGTCAC CAACTG-3’ (forward) and 5’- GGCACACGCAGCTCATTG-3’ (reverse).
Yahiro K., Ogura K., Terasaki Y., Satoh M., Miyagi S., Terasaki M., Yamasaki E, & Moss J. (2019). Cholix toxin, an eukaryotic elongation factor 2 ADP-ribosyltransferase, interacts with Prohibitins and induces apoptosis with mitochondrial dysfunction in human hepatocytes. Cellular microbiology, 21(8), e13033.
+ Open protocol
+ Expand
4

Reverse Transcription qPCR Amplification

Check if the same lab product or an alternative is used in the 5 most similar protocols
PrimeScript™ RT Master Mix (TaKaRa Bio Inc.) was used to amplify the cDNA in 10 μL of PCR mixture, as per the manufacturer’s instructions. KOD SYBER qPCR Mix (Toyobo, Osaka, Japan) and ABI Prism 7000 (PerkinElmer Life Sciences, Boston, MA, USA) were used to perform RT-qPCR. Table 2 shows the primers used for PCR. Relative expression levels were normalized to GAPDH and calibrated to the respective controls.
Yahiro K., Ogura K., Tsutsuki H., Iyoda S., Ohnishi M, & Moss J. (2021). A novel endoplasmic stress mediator, Kelch domain containing 7B (KLHDC7B), increased Harakiri (HRK) in the SubAB-induced apoptosis signaling pathway. Cell Death Discovery, 7, 360.
+ Open protocol
+ Expand
5

Quantitative PCR Analysis of mRNA

Cited 1 time
Check if the same lab product or an alternative is used in the 5 most similar protocols
Total mRNA was purified by ISOGEN II (NIPPON GENE) from SubAB-treated cells, STEC strains, or intraperitoneal SubAB-injected mice, and then cDNA was amplified using PrimeSTAR HS DNA Polymerase (TaKaRa Bio Inc.) in a 20 μl PCR mixture according to the manufacturer’s protocol. Real-time quantitative PCR analysis was used with KOD SYBER qPCR Mix (TOYOBO) and ABI Prism 7000 (PerkinElmer Life Sciences). Primers used for PCR are shown in Supplementary Table S1. Relative expression was normalized to gapdh or etuA and calibrated to the respective controls73 (link).
Yahiro K., Ogura K., Goto Y., Iyoda S., Kobayashi T., Takeuchi H., Ohnishi M, & Moss J. (2020). Subtilase cytotoxin induces a novel form of Lipocalin 2, which promotes Shiga-toxigenic Escherichia coli survival. Scientific Reports, 10, 18943.
+ Open protocol
+ Expand
6

Quantitative Gene Expression Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA was extracted from A549 cells by TRIzol® RNA isolation (Gibco, Thermo Fisher Scientific, Inc.) and purified with DNase I (Invitrogen, Thermo Fisher Scientific, Inc.) according to the manufacturer’s protocol. The primer sequences are available upon request. RNAs were reverse-transcribed into cDNA using SuperScript™ II (Invitrogen Life Technology). Real-time quantitative PCR was performed by fluorescent dye SYBR Green methodology using SYBR Green PCR Master Mix (Applied Biosystems) and the ABI Prism 7000 apparatus (Perkin-Elmer, Foster City, CA, USA). Gene expression was normalized to the corresponding β-actin level and is presented as the fold change relative to that of the control.
Wang Z., Wang W., Xiang T., Gong B, & Xie J. (2022). Serum Uric Acid as a Diagnostic Biomarker for Rheumatoid Arthritis–Associated Interstitial Lung Disease. Inflammation, 45(4), 1800-1814.
+ Open protocol
+ Expand
7

Quantifying Inflammatory Gene Expression in HIV Rat Brains

Check if the same lab product or an alternative is used in the 5 most similar protocols
Five- and 9-month-old HIV-tg and wt rats were lightly anesthetized with CO2, decapitated, and the brain excised from the cranium. The motor and somatosensory cortex were dissected on ice and immediately frozen on dry ice, and stored at −80°C. Cortical tissue (100 mg) was homogenized in Qiagen® lysis solution and total RNA was isolated by phenol-chloroform extraction using a RNeasy® lipid tissue mini-kit (Qiagen, Valencia, CA, USA) and 2 μg total RNA was used for reverse transcription (SuperScript™II, Invitrogen). qPCR was carried out on a Perkin Elmer ABI PRISM 7000 sequence detection system using 2.5 μL cDNA as a template, in combination with 1 Å~ Power SYBR Green Master Mix (Applied Biosystems, Foster City, CA, USA), and optimized forward and reverse primers for tumor necrosis factor alpha (TNFα) or interleukin-1 beta (IL1β). The 50 μL reaction mixtures were held at 50°C for 2 min, 95°C for 10 min, followed by 40 cycles at 95°C for 15 s and 1 min at 60°C. Amplification curves were generated with sequence detection system 1.9.1 software (Applied Biosystems). Mean-fold change in threshold cycle values over time-matched saline vehicle controls was calculated according to the ΔΔCT method (Livak and Schmittgen 2001 (link)) and normalized to ribosomal protein L32. Data (n = 4 per group) are expressed as the relative level of the target gene as fold change from control.
Avdoshina V., Caragher S.P., Wenzel E.D., Taraballi F., Mocchetti I, & Harry G.J. (2017). The viral protein gp120 decreases the acetylation of neuronal tubulin: potential mechanism of neurotoxicity. Journal of neurochemistry, 141(4), 606-613.
+ Open protocol
+ Expand
8

Quantifying VEGFR-1 and VEGFR-2 Transcripts

Check if the same lab product or an alternative is used in the 5 most similar protocols
Quantification of membrane VEGFR‐1 and VEGFR‐2 transcripts was performed by quantitative real‐time reverse transcriptase‐polymerase chain reaction (qRT‐PCR) according to the dual‐labelled fluorigenic probe method and using an ABI Prism 7000 sequence detector (PerkinElmer, Groningen, the Netherlands) and using SYBR green master mix reagent, as previously described.30 Expression levels were calculated by the relative standard curve method. Primers, validated to specifically amplify human VEGFR‐1,12 were as follows: VEGFR‐1, forward 5′‐ACCGAATGCCACCTCCATG‐3′ and reverse 5′‐AGGCCTTGGGTTTGCTGTC‐3′; VEGFR‐2, forward 5′‐GTCTATGCCATTCCTCCCCC‐3′ and reverse 5′‐GAGACAGCTTGGCTGGGCT‐3′. For each sample, the level of VEGFR‐1 or VEGFR‐2 transcripts was normalized to that of 18S RNA (TaqMan® Gene Expression Assay; Applied Biosystems) and referred to the values of the VEGFR‐1 and VEGFR‐2 negative M14 bulk cell line, to which the arbitrary value of 1 was assigned. A melting curve (62‐95°C) was generated at the end of each run to verify specificity of the reactions. The 2‐ΔΔCq relative quantification method was used to calculate mRNA expression.
Atzori M.G., Ceci C., Ruffini F., Trapani M., Barbaccia M.L., Tentori L., D'Atri S., Lacal P.M, & Graziani G. (2019). Role of VEGFR‐1 in melanoma acquired resistance to the BRAF inhibitor vemurafenib. Journal of Cellular and Molecular Medicine, 24(1), 465-475.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!