Ab155419
Ab155419 is a laboratory equipment product offered by Abcam. It is a purified antibody designed for use in various experimental applications. The core function of this product is to serve as a specific binding agent for targeted antigens or molecules of interest.
Lab products found in correlation
4 protocols using ab155419
Detecting eIF3d Protein Expression
EIF3D Protein Expression Analysis in HCT116 Cells
Quantifying eIF3d Expression in Tissue Sections
Immunoblotting and IHC Protocols for Cancer Stem Cell Markers
EIF3D shRNA and control shRNA were bought from Addgene. The sequence of shEIF3D was: 5ʹ -
GCGTCATTGACATCTGCATGACTCGAGTCATGCAGATGTCAATGACGCTTTTTT-3ʹ
GRP78 siRNA was bought from Riobio (China).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!