The largest database of trusted experimental protocols

Ab155419

Manufactured by Abcam
Sourced in United States

Ab155419 is a laboratory equipment product offered by Abcam. It is a purified antibody designed for use in various experimental applications. The core function of this product is to serve as a specific binding agent for targeted antigens or molecules of interest.

Automatically generated - may contain errors

4 protocols using ab155419

1

Detecting eIF3d Protein Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols
Western blotting to detect the eIF3d protein was performed using standard methods. Total protein was extracted from transfected cells with RIPA buffer, and the protein concentration was measured using a BCA Protein assay kit (Thermo Fisher Scientific, Inc.). The protein samples (30 µg) were subjected to SDS-PAGE (Bio-Rad, USA), transferred onto PVDF membranes and incubated overnight with primary antibodies at 4 °C. On the 2nd day, the membranes were incubated with secondary antibody at room temperature for 2 h. Immunoreactive bands were detected with an ECL western blotting system (Clarity Western ECL Substrate; Bio-Rad). The antibodies used in this study were as follows: rabbit anti-GAPDH (ab119716, Abcam), rabbit anti-eIF3d antibody (ab155419, Abcam), and goat anti rabbit IgG H&L (ab6721, Abcam).
+ Open protocol
+ Expand
2

EIF3D Protein Expression Analysis in HCT116 Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
After infection for 5 days, HCT116 cells were washed with ice-cold PBS and then lysed in 2× SDS sample buffer [100 mM Tris–HCl (pH 6.8), 10 mM EDTA, 4% (w/v) SDS, 10% (v/v) glycine] for 1 h at 4 °C. The lysates were clarified by centrifugation at 13 000× g for 30 min at 4 °C and the supernatants were employed for further analysis. The total protein concentration was estimated using BCA (bicinchoninic acid) protein assay kit. Protein samples (30 μg) were loaded and electrophoresed in a SDS–PAGE (10% gel) at 50 V for 3 h, and subsequently transferred to PVDF membranes (Millipore) at 300 mA for 1.5 h. After being blocked with TBST (Tris-buffered saline Tween-20) [20 mM Tris (pH7.6), 150 mM NaCl, 0.01% Tween-20] containing 5% (w/v) non-fat dried skimmed milk powder for 1 h at room temperature, membranes were probed with rabbit anti-EIF3D (abcam, #ab155419, dilution 1:1000), or mouse anti-GAPDH (Santa cruz, #Sc-32233, dilution 1:60 000) overnight at 4 °C. After washing by TBST, the membrane was incubated with HRP (horseradish peroxidase)-labelled anti-rabbit (Santa cruz, #Sc-2054, dilution 1:5000) or anti-mouse (Santa cruz, #Sc-2005, dilution 1:5000) secondary antibody at room temperature for 2 h. The membranes were analysed using super ECL detection reagent. Each experiment was repeated three times.
+ Open protocol
+ Expand
3

Quantifying eIF3d Expression in Tissue Sections

Check if the same lab product or an alternative is used in the 5 most similar protocols
A polyclonal antibody against eIF3d (ab155419; Abcam, Cambridge, MA, USA) was used in this study. Specimens were sectioned into 3- to 4-μm slices. After routine xylene dewaxing and gradient ethanol hydration, the slides were blocked with 3% hydrogen peroxide for 10 min. After using the microwave antigen repair method, the slides were incubated with the anti-eIF3d Ab (diluted 1:40 in phosphate buffered saline [PBS]) at 4°C for 24 h. Sections were washed thrice with PBS, followed by the addition of diaminobenzidine for 6 min. Slides were independently evaluated by two pathologists who were blinded to clinical data. The level of eIF3d was scored not only by staining intensity but also by the percentage of cells that exhibit eIF3d. The staining intensity was scored as 0 (no staining), 1 (weak), 2 (moderate), or 3 (intense staining). The percentage of positive cells was scored as follows: 0 (≤5%), 1 (6% to 25%), 2 (26% to 50%), and 3 (>50%). The total of the above two scores was graded as follows: 0 (score 0), 1 (score 1–2), 2 (score 3–4), and 3 (score 5–6), where the total scores of 0 or 1 were designated as low expression and 2 or 3 were designated as high expression.21 (link)
+ Open protocol
+ Expand
4

Immunoblotting and IHC Protocols for Cancer Stem Cell Markers

Check if the same lab product or an alternative is used in the 5 most similar protocols
EIF3D (1:500 for Immunoblot, 1:50 for IHC, ab155419, Abcam), Ki67 (1:100 for IHC, ab15580, Abcam), CD44 (1:500, ab189524, Abcam), CD133 (1:500 for Immunoblot, 1:100 for IHC, ab222782, Abcam), SOX2 (1:500, ab92494, Abcam), ALDH1 (1:1000, ab177463, Abcam), FAK (1:1000, ab40794, Abcam), p-FAK (1:500 for Immunoblot, 1:50 for IHC, ab81298, Abcam), GRP78 (1:500 for Immunoblot, 1:50 for IHC, ab38449, Abcam, ab21685, Abcam), and β-actin (1:2000, ab8226, Abcam) were diluted in the indicated ratio and purchased from the indicated company.
EIF3D shRNA and control shRNA were bought from Addgene. The sequence of shEIF3D was: 5ʹ -
GCGTCATTGACATCTGCATGACTCGAGTCATGCAGATGTCAATGACGCTTTTTT-3ʹ
GRP78 siRNA was bought from Riobio (China).
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!