Rnase a

Cells (2 × 10⁵) were seeded on a culture dish (radius of 17.5 mm). Two days after seeding, the cells were dispersed with trypsin-EDTA. The cells were washed with phosphate-buffered saline (PBS) and fixed with 70% iced ethanol with PBS for 30 min or more on ice. After fixation, the cells were incubated with 50 μg/mL propidium iodide and 50 μg/mL RNase A (Macherey-Nagel, Düren, Germany) in PBS for 30 min at 37°C. After incubation, the cell cycle phase was detected using a FACSCalibur cell analyzer (BD Biosciences).

After 48 h of Wnt3a stimulation, siRNA-transfected cells were resuspended in 0.5 mL of ice-cold 70% ethanol after centrifugation and kept at −20°C for 24 h. Following washing in PBS, cells were resuspended in 10 mg/mL RNase A (Macherey-Nagel, Düren, Germany, catalog #740505) in PBS for 30 min at 37°C and stained with 1 mg/mL PI (Sigma-Aldrich, catalog #P4170) for 30 min at 37°C. After washing with PBS, cells were resuspended in fresh PBS, and data were acquired using a DNA flow cytometer. After treating the siRNA-transfected cells with Wnt3a, caspase-3 assays were performed according to the manufacturer's protocol (Medical & Biological laboratories, Nagoya, Japan, catalog #4800) to detect caspase-3 activity. Cell lysates, 2× reaction buffer and caspase-3 substrate were added to each well and incubated for 2 h at 37°C, then the absorbency of the samples was measured with a microplate reader at a wavelength of 405 nm. The data were calculated based on the standard curve and normalized to the total protein concentration of the cell extracts.

RNA was extracted using Trizol^® reagent (Invitrogen, Darmstadt, Germany) according to manufacturer's protocol. Extracted RNA was treated with DNAse I (Ferments Life Science, Waltham, MA, USA) and reverse transcribed with ReverseAid kit (Fermentas) according to manufacturer's instructions. Real time PCRs reactions were prepared according to Applied Biosystems guidelines using SybrGreen assay and performed in a StepOnePlus instrument (Applied Biosystems, Carlsbad, CA, USA). PCR efficiencies were monitored for each sample according to a previously described approach [46 (link)]. Results are presented as relative quantification. SybrGreen Primers used:
CVB fw 5′ GGCCCCTGAATGCGGCTAAT 3′,
CVB rev 5′ TGGCTGCTTATGGTGACAATTG 3′;
Microglobulin β2 fw 5′ TTTACTCACGTCATCCAGCAG A 3′;
Microglobulin β2 rev 5′ CGGCAGGCATACTCATCTTT 3′.
RNAse treatment
CVB3 infected FFPE human islets sections were prepared as described above. To digest any viral or endogenous RNA 100µg/ml RNAse A (Macherey-Nagel) in 2xSSC buffer or 2xSSC Buffer alone was applied to the sections for 1h at 37°C. At this salt-concentration (150mM NaCl) single-stranded, as well as double-stranded RNA, is enzymatically cleaved by RNAse A [47 ].

One hundred milligram of seeds (dry weight) were pulverized in liquid nitrogen with mortar and pestle. Soluble or total proteins were directly extracted from the powder in native or denaturing conditions. For native extracts, soluble proteins were resuspended for 2 h at 4 °C under constant rotation in a native buffer containing 50 mM HEPES pH 7.5; 150 mM NaCl, 1 mM EDTA; 1 mM EGTA; 0.25% (w/v) Triton X-100; 5 mM DTT; 50 U ml⁻¹ DNase I (Roche); 5 U ml⁻¹ RNase A (Machery Nagel); 1 U ml⁻¹ macerozyme (Boehringer-Mannheim). For total extracts, proteins were solubilized in a buffer containing 50 mM HEPES pH 7.5; 2.5% (w/v) SDS; 5 mM DTT. Both soluble and total protein extraction buffers were supplemented with 1% (v/v) of protease inhibitor cocktail special plant (Sigma) and 1% (v/v) phosphatase inhibitor cocktail 2 and 3 (Sigma). Protein fractions from seed extracts were purified by repeated centrifugation until lipid free samples were obtained. Protein concentrations of extracts were quantified by BCA protein assays (Thermo) against BSA standard dilution curve and directly used for downstream applications.

Cisplatin [cis-diamineplatinum (II) dichloride (P4394)], camptothecin (C9911), doxorubicin (D1515), H₂O₂ (H1009) and etoposide (E1383) were purchased from Sigma-Aldrich (Saint-Louis, MO, USA). The stock solution of Cisplatin (2.5 mM in water) was kept at –20°C and renewed every month. JNK-IN-8 (420150) was purchased from Calbiochem (San Diego, CA, USA) and MitoTracker Red CMXROS (9082) from Cell Signaling Technology (Danvers, MA, USA). RNAse A (740505) was from Macherey-Nagel (Allentown, PA, USA). Accutase (L0950-100) was from Biowest (Nuaillé, France). The list of primary and secondary antibodies used in this study is provided in Supplementary Table S1.

Human microglia were treated with Mock or JEV (at a multiplicity of infection (MOI) of 10 TCID₅₀/cell) in RPMI-1640 GlutaMAX^TM-I medium at 37 °C and 5% CO₂ during various time-periods. Supernatants were collected and pre-treated human microglia were washed 5 times with cold PBS. Both supernatants and last washing was verified negative for infectious JEV by end-point titration. Subsequently, susceptible target BHK-21 cells were co-cultured with pre-treated human microglia in RPMI-40 GlutaMAX^TM-I medium, at 37 °C in 5% CO₂. Co-cultures were performed in commercial porcine serum (Thermofischer Scientific). After various time-periods of co-culture, supernatants and cells were collected for further analysis.
In some experiments, immune porcine serum of vaccinated pigs with neutralizing activity against Nakayama isolate at a titre of 1:320²² and previously described commercial porcine serum was used as control. In other experiments, CX₃CR1 antagonist (AZD8797, Axon Biochemicals, Groningen, The Netherlands) suspended in DMSO (Thermofischer Scientific) and/or RNAse A (Macherey Nagel, Düren, Germany) suspended in PBS were used. DMSO and PBS were respectively used as controls. These reactive were put on top of treated microglial cells before the addition of BHK-21 cells for co-cultures.