RS was determined from FFPE tissue as previously described [12 (link)]. In brief, H&E slides were reviewed to ensure the presence of sufficient invasive BC, and RNA was then extracted from eight 5-μm unstained sections. The total RNA content was measured, and the absence of DNA contamination was verified. Gene-specific reverse transcription was performed, followed by standardized quantitative RT-PCR in 384-well plates using the Applied Biosystems QuantStudio™ Dx Real-Time PCR System (Foster City, CA). The expression of each gene was measured and normalized relative to a set of five reference genes. The reference-normalized expression measurements range from 0 to 15, and a 1-unit increase reflects an approximately twofold increase in RNA expression. A tumour is ER-negative when it presents < 6.5 expression units; ER-positive, ≥ 6.5; PR-negative, < 5.5; PR-positive, ≥ 5.5; HER-2-negative, < 10.7; HER-2-equivocal, ≥ 10.7–11.4; or HER-2-positive, ≥ 11.5 [38 (link)]. RS, ranging from 0 to 100, was derived from the reference-normalized expression measurements for the 16 cancer-related genes. Patients were then categorized into low-risk (< 18), intermediate-risk (18–30), and high-risk (≥ 31) groups [12 (link)]. We also investigated low- and midrange-risk groups as follows: low (< 11), intermediate (11–25), and high (≥ 26) [39 (link)–41 (link)].
Quantstudio dx real time pcr system
Manufactured by Thermo Fisher Scientific
Sourced in United States
The Quantstudio™ Dx Real-Time PCR System is a laboratory instrument designed for real-time polymerase chain reaction (PCR) analysis. It is capable of precise quantification and detection of nucleic acid sequences.
Automatically generated - may contain errors
Lab products found in correlation
Eastep super total rna extraction kit, by Promega (2 mentions)
Ez press rna purification kit, by EZBioscience (1 mentions)
Hifair 3 1st strand cdna synthesis supermix, by Yeasen (1 mentions)
7900ht fast real time pcr system, by Thermo Fisher Scientific (1 mentions)
Reverse transcription kit, by Promega (1 mentions)
Trizol total rna isolation reagent, by Thermo Fisher Scientific (1 mentions)
Primescript 2 1st strand cdna synthesis kit, by Takara Bio (1 mentions)
Quantitect reverse transcription reagent, by Qiagen (1 mentions)
Rneasy micro kit, by Qiagen (1 mentions)
Primescript rt master mix, by Takara Bio (1 mentions)
Trizol reagent, by Takara Bio (1 mentions)
Tb green premix ex taq, by Takara Bio (1 mentions)
Nanodrop one spectrophotometer, by Thermo Fisher Scientific (1 mentions)
Goscript reverse transcription mix, by Promega (1 mentions)
Gotaq qpcr master mix, by Promega (1 mentions)
7 protocols using quantstudio dx real time pcr system
1
Determination of Breast Cancer Subtypes
2
miRNA and mRNA Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
In 24–36 h after transfection, cells were collected and the total RNA was extracted by using EZ-press RNA Purification Kit (EZBioscience, Roseville, California, USA) following the manufacturers’ protocol. Reverse transcriptions were carried out using Hifair® III 1st Strand cDNA Synthesis SuperMix (Yeasen, Shanghai, China) according to the manufacturers’ guidance. QRT-PCR was performed using a 7900 HT Fast Real-Time PCR System (7900HT Fast, Applied Biosystems, USA) and a QuantStudio Dx Real-Time PCR System (QuantStudio Dx, Applied Biosystems, USA). U6 was used to normalize miR-186-5p, and β-actin was used for mRNA normalization. The primers were synthesized by the Generay Biotech (Shanghai, China). Sequences of all primers were as follows (5′ to 3′), U6-F: GTGCTCGCTTCGGCAGCACATATAC, U6-R: AAAAATATGGAACGCTCACGAATTTG; 186-5p-F: CTCCAACGCAAAGAATTCTCC, 186-5p-R: TATGCTTGTTCTCGTCTCTGTGTC; β-actin-F: CATGTACGTTGCTATCCAGGC, β-actin-R: CTCCTTAATGTCACGCACGAT; ANXA9-F: CAGCTCATCTCACGAAACTTCC, ANXA9-R: GGTTCGAGTGGCAAGAATTTCAA. 2−△△Ct formula was used to calculating the relative expression level of a miRNA or mRNA.
3
Quantifying TNFSF13B Expression in Adrenocortical Carcinoma
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
From 2013 to 2020, 14 ACC specimens were collected from the Department of Urology at Ruijin Hospital, Shanghai Jiao Tong University School of Medicine. The study conformed to the provisions of the Declaration of Helsinki (as revised in 2013). The institutional Committee abandoned the ethical review because it did not affect the treatment strategy. Informed consent to use their tissues for research was obtained from each patient prior to surgery. The samples were stored in liquid nitrogen. Then, total RNA was extracted by the Eastep® Super Total RNA Extraction Kit (Promega, China). A reverse-transcription kit (Promega, China) was used to reverse transcription of total RNA into the first strand of complementary DNA. QPCR was then performed with a Quantstudio™ Dx Real-Time PCR System (Thermo Fisher Scientific, USA). Endogenous gene glyceraldehyde 3-phosphate dehydrogenase (GAPDH) was used as a reference control. Genes were amplified by the following specific primers: GAPDH forward (5'-GGAGCGAGATCCCTCCAAAAT-3'), GAPDH reverse (5'-GGCTGTTGTCATACTTCTCATGG-3'); TNFSF13B forward (5'-GGGAGCAGTCACGCCTTAC-3'), and TNFSF13B reverse (5'-GATCGGACAGAGGGGCTTT-3'). The experiment was repeated twice, and the average Ct from the values obtained for each reaction was calculated. The fold change of the target genes against that of the reference gene was calculated from the 2−ΔΔCt values.
4
Quantitative Gene Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated using TRIzol total RNA isolation reagent (Thermo, Waltham, MA, USA), and the reverse transcription was performed using PrimeScript II 1st Strand cDNA Synthesis Kit (Takara, Japan). The qPCR analysis was performed on QuantStudio Dx real-time PCR system (Thermo, Waltham, MA, USA). Primers used in this study are listed as follows: KLF4 5′-CATCTCAAGGCACACCTGCGAA-3′ (Forward)/5′-TCGGTCGCATTTTTGGCACTGG-3′ (Reverse), SLC6A4 5′-TCACAGTGCTCGGTTACATGGC-3′ (Forward)/5′-GAAAGTGGACGCTGGCATGTTG-3′ (Reverse), SLC39A7 5′-GACCACAATGACTGTCCTGCTAC-3′ (Forward)/5′-GCTGTCAGTAGTTGCAGACGCA-3′ (Reverse), SLC51A 5′-TCTTCCTGGAGGATGCCGTCTA-3′ (Forward)/5′-TCCAGAGACCAAAGCAGCACAG-3′ (Reverse), SLC12A7 5′-CCTCAAGGATGCACAGAAGTCC-3′ (Forward)/5′-CGTAAGACCACGCCTTCAATGC-3′ (Reverse), β-actin 5′-CACCATTGGCAATGAGCGGTTC-3′ (Forward)/5′-AGGTCTTTGCGGATGTCCACGT-3′ (Reverse).
5
Quantifying IDO mRNA in Dendritic Cells
6
Quantifying CD276 mRNA Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from OV and CESC tissues and cell lines using Trizol reagent (TaKaRa, China). Subsequently, RT-qPCR was performed using the PrimeScript RT Master Mix (#RR036A, TaKaRa, China) and TB Green Premix Ex Taq (#RR820A, TaKaRa, China) by the QuantStudioDx Real-Time PCR system (ThermoScientific, USA). The relative mRNA expression levels were calculated by the 2-ΔΔCt method. The primers used were as follows: CD276: forward: CAGGGCAGCCTATGACATTC and reverse: CCTCACAGCTCTGTTTGATCTT; and GAPDH: forward: GTCGGAGTCAACGGATTTGG and reverse: CGGTGCCATGGAATTTGCC.
7
Quantitative Analysis of TNIK Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA was extracted from PTC tissues and corresponding adjacent tissues using the Eastep® SuperTotal RNA Extraction Kit (Promega Corp.) according to the manufacturer's protocol. RNA concentration and quality were assessed using a NanoDrop® One spectrophotometer (Thermo Fisher Scientific, Inc.). The GoScript™ Reverse Transcription Mix (Promega Corp.) was used to generate cDNA from RNA according to the manufacturer's instructions. The amplification reaction was performed using GoTaq® qPCR Master Mix (Promega Corp.) according to the manufacturer's protocol. The qPCR procedure was as follows: 95°C for 10 min followed by 40 cycles of 95°C for 15 sec and 60°C for 1 min. qPCR was performed using a QuantStudio DX Real-Time PCR system (Thermo Fisher Scientific, Inc.) with each reaction run in triplicate. The relative target gene mRNA expression was determined using the comparative Ct method (27 (link)), with GAPDH as the endogenous control. The primer sequences were as follows: TNIK forward, 5′-GGTAGAAGAACGGTCAAGGCTCAAC-3′ and reverse, 5′-GGCTGAACTCCACTAATGCTGAAGG-3′; GAPDH forward, 5′-AATCCCATCACCATCTTCCA-3′ and reverse, 5′-TGGACTCCACGACGTACTCA-3′.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!