Anti c myc 9e10

Embryos were fixed at stage 12 following the protocol previously detailed by Jones et al., (2014) (link) (Jones et al., 2014 (link)). Embryos were incubated in primary and secondary antibodies in TBSN/BSA (Tris- buffered saline: 155mM NaCl, 10mM Tris-Cl [pH 7.4]; 0.1% Nonidet P-40; 10 mg/ml BSA) overnight at 4°C, with five 1 hour washes with TBSN/BSA following each incubation. Primary antibodies were: anti-β-catenin at 1:200 dilution, raised in rabbit (Abcam) and anti c-myc 9E10 at 1:1000 dilution, raised in mouse (Santa-cruz). Alexa Fluor secondary antibodies, anti-rabbit 488 and anti-mouse 568 (Life Technologies) were used at a dilution of 1:400. After staining, embryos were methanol dehydrated, then cleared and mounted in Murray’s Clear (2:1, benzyl benzoate:benzyl alcohol; (Klymkowsky and Hanken, 1991 )). Images were collected on a Leica TCS SP5 AOBS inverted confocal using a 63x HCX PL APO (Oil λBL) objective and 1024 × 1024 format. Single confocal slices are shown in the results.

Samples were separated under reducing conditions on 10–20% Tris-glycine gels and transferred onto nitrocellulose membranes and probed with either anti-c-myc (9E10, cat#ab206486, Abcam) or anti-FLAG (M2, cat#F480, Sigma-Aldrich) mAbs (1 µg/ml), followed by incubation with DyLight800-goat anti-mouse (GAM) IgG (1:5000 dilution) (cat#610-145-121, Rockland Immunochemicals). Visualization of protein bands was performed with the Odyssey^® system (LI-COR Biosciences).

SDS-PAGE, immunoblotting, and real-time PCR analyses were performed as previously described.^{62 (link),63 (link)} Gel electrophoresis was conducted using the NuPAGE system with 4–12% pre-cast gradient gels and MES/SDS running buffer (Thermo Fisher Scientific, Waltham, MA). For human mesencephalic tissues, primary antibodies for NLRP3 were the same as described above. The following antibodies were used for cell culture lysates and immunoprecipitation assays: anti-NLRP3/NALP3 (Adipogen, San Diego, CA; Cell Signaling Technology, Danvers, MA), anti-c-Myc [9E10] (Abcam, Cambridge, MA), anti-Ubiquitin (Cell Signaling, Danvers, MA), anti-BiP (HSPA5) (Cell Signaling, Danvers, MA), anti-Nurr1 (Santa Cruz Biotechnology, Dallas, TX), anti-tyrosine hydroxylase (Abcam, Cambridge, MA), and anti-actin horseradish peroxidase (HRP)-coupled (Sigma-Aldrich, St. Louis, MO) antibodies. Immunoreactivity was detected using HRP-conjugated anti-rabbit and anti-mouse secondary antibodies (Millipore, Billerica, MA) as appropriate in combination with a chemiluminescent detection method (ECL-Plus, Thermo Fisher Scientific, Waltham, MA). NLRP3 transcripts were analyzed using real-time PCR with amplification detected using SYBR Green (Bio-Rad Laboratories, Hercules, CA), NLRP3 forward primer: CACTTCCAGTTTTTGCCGGG, and NLRP3 reverse primer: GGGAATGGCTGGTGCTCAAT.