Calcium phosphate transfection method

Manufactured by Takara Bio

The calcium phosphate transfection method is a technique used to introduce foreign genetic material, such as plasmid DNA, into mammalian cells. It involves the formation of a calcium phosphate-DNA co-precipitate that is then taken up by the cells. This method allows for the efficient delivery of DNA into a variety of cell types.

Automatically generated - may contain errors

Lab products found in correlation

Hek293t cells, by Takara Bio (1 mentions) Polybrene reagent, by Merck Group (1 mentions) Lenti x, by Takara Bio (1 mentions)

Close spelling variants of this product

Calcium phosphate (23 citations) Calcium phosphate method (6 citations) Calcium phosphate transfection (3 citations)

2 protocols using calcium phosphate transfection method

Lentiviral Knockdown of Insulin Signaling

Check if the same lab product or an alternative is used in the 5 most similar protocols

4–6 murine miR-shRNAs from Open Biosystems were screened per target and the most potent miR-shRNAs identified were cloned into either pSLIK-NEO or pTRIPZ-PURO (Open Biosystems) lentiviral expression vectors, as previously described18 (link), and targeted the sequences: CTGGGACTGGAGCAAACACAA (Insr), GGATCCCATATCAGTTTCTAA (Insr), TTGGGTG- GAGAGAGTATTAAA (Irs1) and ACTCGGACAGCTTCTTCTTCA (Irs2). Virus was packaged by transfecting the lentivector expression vectors along with third-generation lentivirus packaging and pseudotyping plasmids (pMDLg/pRRE, pRSVREV and pVSV-G) into HEK293T cells using the calcium phosphate transfection method (Clontech). 3T3-L1 preadipocytes were infected with pTRIPZ virus at low MOI to ensure that most transduced cells contained single integrants. After puromycin selection cells were infected with pSLIK, also at low MOI, and selected with both G418 and puromycin.

Groeneveld M.P., Brierley G.V., Rocha N.M., Siddle K, & Semple R.K. (2016). Acute knockdown of the insulin receptor or its substrates Irs1 and 2 in 3T3-L1 adipocytes suppresses adiponectin production. Scientific Reports, 6, 21105.

+ Open protocol

+ Expand

Overexpression of miR-200 Clusters

Check if the same lab product or an alternative is used in the 5 most similar protocols

For miR200 overexpression, genomic fragments encoding cluster-A (miR200b/200a/429) or cluster-B (miR200c/141) cloned into pLenti 4.1Ex backbone vector were obtained from Add gene plasmid repository, plasmids 35533 and 35534, respectively. Lentivirus production involved five plasmid co-transfection of 293FT cells, involving the lentiviral expression cassette containing the gene of interest (GOI), tat, rev, gag/pol, and vsv-g plasmids (in the ratio 20:1:1:1:2) using calcium phosphate transfection method (Clontech Laboratories Inc.) and LentiX (Clontech Laboratories Inc.)-mediated concentration of viral particles and titering before storage at −80°C in aliquots for long-term use. All virus infections used 5 µg/ml Polybrene reagent (EMD Millipore).

Bhatt S., Gupta M.K., Khamaisi M., Martinez R., Gritsenko M.A., Wagner B.K., Guye P., Busskamp V., Shirakawa J., Wu G., Liew C.W., Clauss T.R., Valdez I., Ouaamari A.E., Dirice E., Takatani T., Keenan H.A., Smith R.D., Church G., Weiss R., Wagers A.J., Qian W.J., King G.L, & Kulkarni R.N. (2015). Preserved DNA Damage Checkpoint Pathway Protects against Complications in Long-Standing Type 1 Diabetes. Cell metabolism, 22(2), 239-252.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!