Multiskan go microplate spectrophotometer

Manufactured by Thermo Fisher Scientific

Sourced in United States, Finland, United Kingdom, China, Germany, France, Italy

The Multiskan GO Microplate Spectrophotometer is a versatile laboratory instrument designed for absorbance measurements in microplates. It provides accurate and reliable absorbance data across a wide range of wavelengths, enabling various applications in areas such as ELISA, cell-based assays, and nucleic acid quantification.

Automatically generated - may contain errors

Lab products found in correlation

Methyl thiazolyl tetrazolium (mtt), by Merck Group (17 mentions) Dimethyl sulfoxide (dmso), by Merck Group (16 mentions) Crystal violet, by Merck Group (8 mentions) Sorvall st 16r centrifuge, by Thermo Fisher Scientific (7 mentions) Ab9071, by Abcam (7 mentions) Sodium perborate, by Merck Group (7 mentions) Ab63913, by Abcam (7 mentions) Triton x 100, by Merck Group (7 mentions) Mtt solution, by Merck Group (7 mentions) Skanit software, by Thermo Fisher Scientific (6 mentions) Cck 8, by Dojindo Laboratories (6 mentions) Purelink rna mini kit, by Thermo Fisher Scientific (6 mentions) High capacity cdna reverse transcription kit, by Thermo Fisher Scientific (6 mentions) Rpmi 1640, by Merck Group (5 mentions) Cell counting kit 8 (cck8), by Dojindo Laboratories (5 mentions) Prism 5, by GraphPad (5 mentions) μdrop plate, by Thermo Fisher Scientific (4 mentions) Optical microscope, by Olympus (4 mentions) Rneasy mini kit, by Qiagen (4 mentions) Mtt assay, by Merck Group (4 mentions)

Close spelling variants of this product

Multiskan GO (1889 citations) Multiskan GO spectrophotometer (265 citations) Microplate spectrophotometer (222 citations) Multiskan microplate spectrophotometer (51 citations) Multiskan spectrophotometer (46 citations) Multiskan GO microplate (22 citations) Multiskan™ GO UV/Vis microplate spectrophotometer (14 citations) Multiskan™ GO Microplate Spectrophotometer reader (11 citations) Thermo Scientific™ Multiskan™ GO Microplate Spectrophotometer (10 citations) GO microplate spectrophotometer (5 citations)

610 protocols using multiskan go microplate spectrophotometer

Quantifying Oxidative Stress Markers in Plants

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

The previously described method was followed to measure hydrogen peroxide content (H₂O₂) in plant extracts [145 (link)]. The freeze-dried samples (0.3 g each) were blended with 5 mL 0.1% trichloroacetic acid (TCA) in an ice bath and centrifuged at 12,000 rpm for 20 min. The obtained supernatant (0.5 mL) was combined with 10 mM potassium phosphate buffer (0.5 mL, pH 7.0) and 1 M potassium iodide (1 mL). The reaction mixture intensity was recorded at 390 nm using a spectrophotometer (Multiskan^TM GO Microplate Spectrophotometer, Thermo Fisher Scientific, Waltham, MA, USA).
The lipid peroxidation level of freeze-dried samples (0.2 g) was determined by applying the thiobarbituric acid (TBA) test [146 (link)]. The mixture contained 0.5 mL of 0.1% TCA extract that was added to 1 mL of 0.5% TBA (prepared in 20% TCA). The mixture was incubated in boiling water (95 °C, 30 min), followed by cooling in an ice bath (10 min). Subsequently, the homogenate was centrifuged (12,000 rpm, 5 min) and the supernatant absorbance was measured at 532 and 600 nm. The lipid peroxidation level was calculated according to a standard curve (Multiskan^TM GO Microplate Spectrophotometer, Thermo Fisher Scientific, Waltham, MA, USA).

Kazerooni E.A., Maharachchikumbura S.S., Al-Sadi A.M., Rashid U., Kim I.D., Kang S.M, & Lee I.J. (2022). Effects of the Rhizosphere Fungus Cunninghamella bertholletiae on the Solanum lycopersicum Response to Diverse Abiotic Stresses. International Journal of Molecular Sciences, 23(16), 8909.

+ Open protocol

+ Expand

Liver Biomarker and Cytokine Assay Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols

Serum alkaline phosphatase (ALP), alanine aminotransferase (ALT), aspartate aminotransferase (AST), and total bilirubin were measured with a Multiskan GO microplate spectrophotometer (Thermo Scientific, Waltham, MA, USA) using commercially available kits according to the manufacturer’s protocol: ALP, LabAssay ALP Kit (Wako Pure Chemicals); ALT and AST, Transaminase CII-Test Kit (Wako Pure Chemicals); and total bilirubin, Bilirubin QuantiChrom Assay Kit (BioAssay Systems, Hayward, CA, USA). Liver hydroxyproline contents were measured with a Multiskan GO microplate spectrophotometer (Thermo Scientific) using a Hydroxyproline Assay Kit (Biovision, Milpitas, CA, USA). Serum mouse interleukin (IL)-6, IL-10, IL-17, transforming growth factor β1 (TGF-β1), and tumor necrosis factor alpha (TNFα) were also measured using Quantikine ELISA kits (R&D Systems, Minneapolis, MN, USA).

Yamaza T., Alatas F.S., Yuniartha R., Yamaza H., Fujiyoshi J.K., Yanagi Y., Yoshimaru K., Hayashida M., Matsuura T., Aijima R., Ihara K., Ohga S., Shi S., Nonaka K, & Taguchi T. (2015). In vivo hepatogenic capacity and therapeutic potential of stem cells from human exfoliated deciduous teeth in liver fibrosis in mice. Stem Cell Research & Therapy, 6(1), 171.

+ Open protocol

+ Expand

Osteoblast Differentiation and Mineralization Assays

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

For the early osteogenic activity analysis, the osteoblast differentiation of MC3T3-E1 cells was induced for 7 days, and alkaline phosphatase (ALP) staining and activity tests were performed, as previously described [48 (link)]. Briefly, for the ALP staining assay, the cells were incubated for 1 h at 37 °C with an ALP reaction solution (Takara Bio Inc., Tokyo, Japan) and the level of ALP staining was observed using a scanner and a light microscope. To conduct the ALP activity assay as previously described [48 (link)], an alkaline phosphatase activity colorimetric assay kit (Biovision, Milpitas, CA, USA) was used and the ALP activity was quantitatively detected at 405 nm using the Multiskan GO Microplate Spectrophotometer (Thermo Fisher Scientific).
For the late osteogenic activity analysis, the differentiation was induced for 21 days, and an Alizarin red S (ARS) staining assay was performed, as previously described [48 (link)]. Briefly, cells were stained with 2% Alizarin red S (pH 4.2) (Sigma-Aldrich) for 10 min, then ARS staining was observed using a scanner and a light microscope, and then the staining level was quantitatively detected at 590 nm using the Multiskan GO Microplate Spectrophotometer (Thermo Fisher Scientific).

Yun H.M., Lee J.Y., Kim S.H., Kwon I.K, & Park K.R. (2022). Effects of Triterpene Soyasapogenol B from Arachis hypogaea (Peanut) on Differentiation, Mineralization, Autophagy, and Necroptosis in Pre-Osteoblasts. International Journal of Molecular Sciences, 23(15), 8297.

+ Open protocol

+ Expand

Cytotoxicity Evaluation of Reagents

Check if the same lab product or an alternative is used in the 5 most similar protocols

To assess cytotoxicity, 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT, Sigma-Aldrich, Cat# M5655) and lactose dehydrogenase (LDH) release assays were conducted. For the MTT assay, SH-SY5Y cells were plated at 4 × 10⁴ cells/well in 24-well plates. Following incubation of the cells with the indicated reagents for 24 h, MTT solution was added to the culture medium and cells were incubated for an additional 2 h. After medium removal, formazan crystal formed in living cells was dissolved in acidified isopropanol. Absorbance was then measured at 570 nm using a Multiskan™ GO microplate spectrophotometer (Thermo Scientific, Waltham, MA, USA). To measure secreted LDH, culture media from cells treated with the specified reagents was collected. The level of released LDH was determined using a CytoTox 96 non-radioactive cytotoxicity assay kit (Promega, Madison, WI, USA, Cat# G1780). Absorbance was measured at 490 nm using a Multiskan™ GO microplate spectrophotometer (Thermo Scientific).

Lee W.J., Lee H.G., Hur J., Lee G.H., Won J.P., Kim E., Hwang J.S, & Seo H.G. (2022). PPARδ Activation Mitigates 6-OHDA-Induced Neuronal Damage by Regulating Intracellular Iron Levels. Antioxidants, 11(5), 810.

+ Open protocol

+ Expand

Quantification of Autoantibody Levels in Rheumatic Diseases

Check if the same lab product or an alternative is used in the 5 most similar protocols

The sBAFF levels were quantified from sera of 101 HS, and 156 RA and 96 pSS patients with a quantitative ELISA test (R&D systems, Minneapolis, USA) performed according to the manufacturer's recommendations. The test reported an analytic sensitivity of 1.01 to 6.44 pg/ml. Furthermore, anti–citrullinated protein antibody (ACPA) levels were also quantified from sera of 314 RA patients by quantitative ELISA test (Orgentec Diagnostika GmbH, Mainz, Germany), performed according to the manufacturer's recommendations. The test reported an analytic sensitivity of 1 U/ml with a cut‐off value of 20 U/ml. The samples were read at 450/540 nm in the Multiskan™ Go Microplate Spectrophotometer (Thermo Fisher Scientific, Massachusetts, USA), absorbance measurements were obtained, and data were analyzed. The anti‐SSA/Ro and anti‐SSB/La levels were quantified in serum from pSS patients by the ORG 208 and ORG 209 ELISA kits (Orgentec Diagnostika GmbH, Mainz, Germany) respectively, according to the manufacturer's instructions. A cutoff value of 25.0 U/ml, with a range detection of 0–200 U/ml, was employed in both ELISA kits. The samples were read at 450 nm by Multiskan™ Go Microplate Spectrophotometer (Thermo Fisher Scientific, Massachusetts, USA). Antinuclear antibodies (ANA) and rheumatoid factor titers were obtained through the clinical files of patients.

Santillán‐López E., Muñoz‐Valle J.F., Oregon‐Romero E., Espinoza‐García N., Treviño‐Talavera B.A., Salazar‐Camarena D.C., Marín‐Rosales M., Cruz A., Alvarez‐Gómez J.A., Sagrero‐Fabela N., Cerpa‐Cruz S, & Palafox‐Sánchez C.A. (2022). Analysis of TNFSF13B polymorphisms and BAFF expression in rheumatoid arthritis and primary Sjögren's syndrome patients. Molecular Genetics & Genomic Medicine, 10(6), e1950.

+ Open protocol

+ Expand

MTT Assay for Cell Viability Assessment

Check if the same lab product or an alternative is used in the 5 most similar protocols

The effect of test compounds on cell viability was assessed by MTT (3-(4, 5-dimethyl thiazol-2yl)-2, 5-diphenyl tetrazolium bromide) assay. Then, 50,000 cells/cm² were seeded onto a 96-well plate and were allowed to grow for 24 h. Then, they were treated with progressive dilution of Quercetin or Probenecid for 24 or 48 h, and afterward, they were incubated with fresh medium containing 0.75 mg/mL MTT for 4 h at 37 °C. Once the medium was removed, a stop solution of 1:1 DMSO and isopropanol with 1% of Triton X-100 was added to dissolve the formazan crystals, and absorbance at 570 nm with blank subtraction at 630 nm was measured using a microplate reader (Multiskan TM GO Microplate Spectrophotometer, Thermo Scientific, Waltham, MA, USA). Viability of treated cells was determined by comparing absorbance values with those of control cells treated with vehicle only.

Abruzzese V., Sukowati C.H., Tiribelli C., Matera I., Ostuni A, & Bisaccia F. (2022). The Expression Level of ABCC6 Transporter in Colon Cancer Cells Correlates with the Activation of Different Intracellular Signaling Pathways. Pathophysiology, 29(2), 173-186.

+ Open protocol

+ Expand

Quercetin Cell Viability Assessment

Check if the same lab product or an alternative is used in the 5 most similar protocols

Cell viability was assessed by the MTT (3-(4, 5-dimethyl thiazol-2yl)-2, 5-diphenyl tetrazolium bromide) assay. In this experiment, 2 × 10⁴ cells were seeded in each well of a 96-well plate. After 24 h, the cells were treated with progressive dilutions of Quercetin, ranging from 660 to 82.5 μM for 24 or 48 h, then incubated with fresh medium containing 0.75 mg/mL MTT for 4 h at 37 °C. The formazan crystals were finally dissolved for 1 h at room temperature on agitation in a mixture 1:1 of DMSO and isopropanol with 1% of Triton X-100. The viability of cells was assessed by comparing the light absorbance at 570 nm, after subtraction of the background at 630 nm, of treated and control cells (treated only with vehicle DMSO), defined as 100% cell viability. Spectrophotometric assays were performed using a microplate reader (Multiskan TM GO Microplate Spectrophotometer, Thermo Scientific, Waltham, MA, USA). Experiments were conducted in triplicate.

Abruzzese V., Matera I., Martinelli F., Carmosino M., Koshal P., Milella L., Bisaccia F, & Ostuni A. (2021). Effect of Quercetin on ABCC6 Transporter: Implication in HepG2 Migration. International Journal of Molecular Sciences, 22(8), 3871.

+ Open protocol

+ Expand

Cell Viability Quantification via MTT Assay

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Cells were seeded at a density of 3000 cells/well in 96-well culture plates in the culture medium for 24 h. Then, the cells were treated with culture medium supplemented with several concentrations of SB505124 (0, 5, 10, and 20 µM) or DMSO (0, 0.1, 0.25, 0.5, 1%) or RA (0, 2.5, 5, 10 and 20 µM) at 37 °C for 72 h in a humidified atmosphere of 5% CO₂ in air. After treatment, cell viability was quantified by MTT assay as previously described [58 (link)]. Briefly, cells were incubated with culture medium supplemented with 0.5 mg/mL 3-(4,5-Dimethylthiazol-2-yl)-2,5-Diphenyltetrazolium Bromide (MTT, Invitrogen) for 3 h at 37 °C. Then, 0.01 M DMSO was added, and the cells were incubated for 10 min at 37 °C. The absorbance at 540 nm was read by Thermo Scientific^TM Multiskan^TM GO Microplate Spectrophotometer (Thermo Fisher Scientific, Waltham, MA, USA). Each treatment condition was performed in 4 replicates.

Nguyen H.T., Theerakittayakorn K., Somredngan S., Ngernsoungnern A., Ngernsoungnern P., Sritangos P., Ketudat-Cairns M., Imsoonthornruksa S., Assawachananont J., Keeratibharat N., Wongsan R., Rungsiwiwut R., Laowtammathron C., Bui N.X, & Parnpai R. (2022). Signaling Pathways Impact on Induction of Corneal Epithelial-like Cells Derived from Human Wharton’s Jelly Mesenchymal Stem Cells. International Journal of Molecular Sciences, 23(6), 3078.

+ Open protocol

+ Expand

Quantifying Cell Viability Using MTT Assay

Check if the same lab product or an alternative is used in the 5 most similar protocols

Undifferentiated and differentiated SH-SY5Y cells were grown at a density of 2 × 10⁴ and 1.4 × 10⁴ cells/well, respectively, on 96-well plates in a final volume of 100 μL/well. Cell viability was assessed by measuring the amount of purple formazan following the reduction of 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT, 0.5 mg/mL, Sigma-Aldrich) by viable cells after 3 h incubation at 37 °C. Absorbance was measured at 570 nm with background subtraction using Thermo Scientific^TM Multiskan^TM GO Microplate Spectrophotometer after dissolving formazan crystals with DMSO 100 μL/well.

Scordino M., Frinchi M., Urone G., Nuzzo D., Mudò G, & Di Liberto V. (2023). Manipulation of HSP70-SOD1 Expression Modulates SH-SY5Y Differentiation and Susceptibility to Oxidative Stress-Dependent Cell Damage: Involvement in Oxotremorine-M-Mediated Neuroprotective Effects. Antioxidants, 12(3), 687.

+ Open protocol

+ Expand

Quantifying Def8 Gene Expression in Drosophila

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted from 30 fly heads using TriZol reagent extraction (Sigma-Aldrich). The RNA concentration was measured for each sample in duplicate using a spectrophotometer (Thermo ScientificTM MultiskanTM GO–Microplate Spectrophotometer). The purity of samples was evaluated using the absorption ratio of 260/280 nm. Reverse transcriptase PCR (RT-PCR) was carried out using the iScript RT kit for the synthesis of complementary DNA (cDNA) (BioRad), with a sample volume equal to 20 µL and a concentration of 250 ng/µL. The obtained cDNAs were used as a template for real-time PCR using Eva's green qPCR master mix (SolisBioDyne) on a StepOne Plus machine (Applied Biosystems). Primer sequences to target Def8 were designed as follows: Fw 5′ TACACGGGCGTTGCCCATT 3′, Rv 5′ TGAGTATCGCAAATCTACCAGGT 3′. 18S gene was employed as a housekeeping gene: Fw 5′ AGAAACGGCTACCACATCCA 3′, Rv 5′ CCCTCCAATGGATCCTCGTT 3′.

Oyarce-Pezoa S., Rucatti G.G., Muñoz-Carvajal F., Sanhueza N., Gomez W., Espinoza S., Leiva M., García N., Ponce D.P., SanMartín C.D., Rojas-Rivera D., Salvadores N., Behrens M.I., Woehlbier U., Calegaro-Nassif M, & Sanhueza M. (2023). The autophagy protein Def8 is altered in Alzheimer's disease and Aβ42-expressing Drosophila brains. Scientific Reports, 13, 17137.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!