Reverse transcription master mix

The mRNA expression of osteogenic differentiation-related genes (ALP, OCN, Runx2, and COL-1) and adipogenic differentiation-related genes (aP2, Adipoq, and PPARγ) was assessed with real-time RT-PCR. After 7 days of incubation in an appropriate induction medium and stimulation with various concentrations of SAA, the total RNA was extracted from cells using EZ-press RNA purification Kit (EZ Bioscience, China) and reverse transcribed to generate complementary DNA using 4× Reverse Transcription Master Mix (EZ Bioscience, China). The forward and reverse primers (BioTNT, China) for cDNAs were designed as indicated in Table 1. A total of 10 μl of mixture comprising 1 μl of cDNA, 0.3 μl of forward primer, 0.3 μl of reverse primer, 5 μl of qPCR SuperMix (BioTNT, China), and 3.4 μl of distillation-distillation H₂O was loaded to each well of a 384-well plate and real-time RT-PCR was performed on 7900HT Fast Real-Time PCR System (Thermo Fisher Scientific, United States). The thermal cycle for RT-PCR was as followed: 95°C for 30 s; 40 cycles at 95°C for 10 s and at 60°C for 30 s. The expression of mRNAs was calculated by the 2^−△△Ct method and the expression of target gene was normalised to that of ß-actin.

Total RNA was extracted using EZ-press RNA Purification Kit (EZBioscience) and then subjected to cDNA synthesis using the 4×Reverse Transcription Master Mix (EZBioscience). The expression of targeted genes was detected by quantitative real-time PCR (qRT-PCR) using the qPCR SYBR Green Master Mix (Yeasen, Shanghai). All experimental procedures were performed according to the manufacture’s protocols. The Ct values were analyzed using the 2^−ΔΔCt method and the final results were normalized to the expression level of Actin, which served as an internal control. The sequences of primers (synthesized by BioSune, Shanghai) used for qRT-PCR are shown in Table 1.
Table 1

Primers used for qRT-PCR analysis

Primers	Forward 5’-3	Reverse 5’-3
Actin	GGCATAGAGGTCTTTACGGATGTC	TATTGGCAACGAGCGGTTCC
IDH2 RNF185	CGCCACTATGCCGACAAAAG GTGTTTACATCAGTGGTTGGAGA	ACTGCCAGATAATACGGGTCA GTGCTGCCCCTTCCATAGAG

Total RNA was extracted from sEVs and cells using the miRNeasy Micro Kit (Qiagen, Germany), RNA was reverse transcribed to cDNA using 4 × Reverse Transcription Master Mix (EZBioscience, USA), and qPCR was performed using SYBR Green qPCR Master Mix (EZBioscience, USA). The primers (Sangon Biotech, China) used in this study are listed in Additional file 1: Table S1.
For miRNA analysis, exosomal miRNAs were isolated by using a miRNeasy Micro Kit (Qiagen, Germany), and cDNA for miRNAs was synthesized using miRNA cDNA 1st strand synthesis (Accurate Biotechnology, China). qRT-PCR was performed using a SYBR Green Premix Kit (Accurate Biotechnology, China), which provides miRNA reverse primers. The miRNA-specific forward primers (Sangon Biotech, China) are listed in Additional file 1: Table S2. Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) and small U6 RNA were used as internal references for mRNA and miRNA, respectively.

For isolating RNA from cells, an RNA purification kit for cells (EZBioscience, Cat. B0004DP) was utilized according to the manufacturer’s protocol. For isolating RNA from cortical bone, femurs and tibia were cleaned of soft tissue and bone marrow and crushed in a tissue grinder machine (Servicebio). RNA was isolated from the bone powder using the RNA purification kit for tissue (EZbioscience, Cat. EZB-RN001-plus) according to the manufacturer’s protocol. An additional DNase1 digestion step was performed to ensure that the samples were not contaminated with genomic DNA. RNA concentration was assessed with Nanodrop spectrophotometers (Thermo Fisher Scientific, QuantStudio™ 7 Flex Real-Time PCR System, QuantStudio Real-Time PCR 1.3).
For reverse transcription, 1000 ng RNA was reverse transcribed using 4×Reverse Transcription Master Mix (EZbioscience, Cat. EZB-RT2GQ). qPCR was performed using 2×SYBR Green Color qPCR Mix (EZbioscience, Cat. A0001-R1) following the manufacturer’s recommendation. Samples were tested on a Quant StudioTM 7 Flex Real-Time PCR System (Thermo Fisher Scientific). The results were calculated using the ΔΔCT method and are presented as the x-fold increase relative to GAPDH mRNA levels. Primers were synthesized by BioSune company and are listed in (Supplementary Table 1b).

Total RNA was isolated using the EZ-press RNA Purification Kit (EZ Bioscience). cDNA was synthesized using 4× Reverse Transcription Master Mix (EZ Bioscience) according to the manufacturer’s instructions. qPCR was performed with 2× SYBR qPCR Mix (KTSM, AlpaLife) using an Applied Biosystems 7300 Plus Sequence Detection System. All primers were synthesized by BioSune. Sequence information on the primers used is provided in Supplemental Table 1.