Sample extractions and analysis were performed as described by Yssouf et al. and Flaudrops et al.27 (link),60 (link). Two biological replicates cut from each truffle gleba were used for protein extraction. Each piece (8–10 mg) was mixed with 400 μL of 70% formic acid (Sigma, Lyon, France), 400 μL of 100% acetonitrile (VWR Prolabo) and ground with acid washed glass beads (Sigma Aldrich, Lyon France) in a polypropylene tube using the FAST Prep®−24 Instrument (MP Biomedicals, Illkirch-Graffenstaden, France). The homogenates were centrifuged for two minutes at 13,000 × g and, 1.5 μL of each supernatant was spotted onto a steel MALDI target plate (Bruker Daltonics, Wissembourg, France) in triplicate and then dried at room temperature for 15 minutes. 1.5 μL of a CHCA matrix suspension (saturated α-Cyano-4-hydroxy-cinnamic acid, 50% acetonitrile, 2.5% trifluoroacetic acid and HPLC water) (Sigma) was then overlaid onto each spot to allow crystallisation. To control loading on the plate, matrix quality and the MALDI-TOF apparatus performance, 1.5 μL of the matrix solution was loaded in triplicate onto the plate with (positive control) or without (negative control) Bruker Protein Calibration Standard I. Finally, the plate was dried at room temperature for 15 minutes and was then immediately introduced into the Autoflex-Speed linear MALDI-TOF MS for analysis (Bruker Daltonics, Germany).
Acid washed glass beads
Manufactured by Merck Group
Sourced in United States, Germany, Belgium
Acid-washed glass beads are a type of laboratory equipment used for various applications. They are manufactured by subjecting glass beads to an acid treatment, which removes impurities and creates a consistent, uniform surface. The acid-washed glass beads are commonly used in laboratory settings to facilitate processes such as filtration, adsorption, and separation.
Automatically generated - may contain errors
Lab products found in correlation
Protease inhibitor cocktail, by Roche (4 mentions)
Disruptor genie, by Scientific Industries (4 mentions)
Nanodrop nd 1000 spectrophotometer, by Thermo Fisher Scientific (3 mentions)
Rneasy mini kit, by Qiagen (3 mentions)
Mini beadbeater, by Biospec (3 mentions)
Trizol, by Thermo Fisher Scientific (2 mentions)
Fastprep 24, by MP Biomedicals (2 mentions)
Bradford assay, by Bio-Rad (2 mentions)
Complete edta free protease inhibitor, by Roche (2 mentions)
Nanodrop 2000, by Thermo Fisher Scientific (2 mentions)
Epsilon 1 6d, by Martin Christ (2 mentions)
Ctab genomic tip 20 kit, by Qiagen (2 mentions)
Fastprep fp120, by MP Biomedicals (2 mentions)
Zymolyase, by G Biosciences (2 mentions)
Qiaamp dna stool mini kit, by Qiagen (2 mentions)
Mouse anti v5, by Thermo Fisher Scientific (2 mentions)
Trans blot turbo, by Bio-Rad (2 mentions)
Phenyl methyl sulfonyl fluoride (pmsf), by Merck Group (2 mentions)
Rabbit anti hexokinase, by Stratech Scientific (2 mentions)
Anti mouse and anti rabbit secondaries, by LI COR (2 mentions)
77 protocols using acid washed glass beads
1
Truffles Protein Profiling by MALDI-TOF
2
Bacterial RNA Extraction and Purification
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted using RNeasy Mini Kit (Qiagen), according to the manufacturer’s instructions, using 50 U recombinant lysostaphin (Sigma) followed by incubation for 5 minutes with 1 ml of hot Qiazol (Qiagen) to lyse bacteria. Bacteria were further disrupted by vibration with 50 mg of acid-washed glass beads (Sigma) using a Mickle Vibratory Tissue Disintegrator (Mickle Laboratory Engineering) at maximum speed. Contaminating DNA was removed using DNA-free™ Kit (Applied Biosystems) and RNA quality tested on an Agilent 2100 Bioanalyzer (Agilent Technologies). RNA concentration and purity were determined by Nanodrop® ND-1000 spectrophotometer (Thermo Scientific). For each strain, at least 4 RNA samples were prepared from independent cultures.
3
Sup35NM and Rnq1 Fiber Formation Assay
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Purified Sup35NM and Rnq1 were resuspended to 300 µM in 7 M guanidine hydrochloride. Rnq1 fibers were formed at 4 °C, 25 °C, and 37 °C and then pooled. Fiber formation and kinetic assays were performed under agitation with acid-washed glass beads (Sigma) as previously described26 (link), with minor alterations to buffers (Sup35: 5 mM KPO4, 150 mM NaCl, pH 7.4; Rnq1: 50 mM KPO4, 2 M Urea, 150 mM NaCl, pH 6).
4
RNA Isolation and Purification from Sinorhizobium
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Cells were harvested, rapidly cooled on ice and pelleted by centrifugation (6.000 x g for 10 min at 4 °C). For Northern blot analysis, RNA was isolated with TRIzol (Ambion). To improve cell lysis, acid-washed glass beads (Sigma) were added and cells were disrupted in a tissuelyser (Retsch) for 15 min. The suspension was incubated at 65 °C for 10 min, and disruption in the tissuelyser was repeated for 15 min. Glass beads were removed by centrifugation. All further steps were performed as instructed by the manufacturer. For qRT-PCR cells were harvested by adding 1 ml of the S. meliloti culture to 1 ml of RNAprotect Bacteria Reagent (Qiagen). Pellets were resuspended in the RTL buffer provided with the RNeasy Mini Kit (Qiagen). Cells were disrupted with glass beads in the tissuelyser for 15 min. Glass beads were removed and all following steps were performed according to the RNeasy Mini Kit. To remove contaminating DNA, RNA was treated with Turbo DNA-free (Ambion).
5
Actin-Profilin Interaction Assay
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Fission yeast cells were grown to OD595 of ∼1.7 at 25ºC. The cells were harvested, washed with water and phosphate-buffered saline (PBS), resuspended in PBS, and broken open by a FastPrep-24 benchtop homogenizer (MP Biomedicals, Santa Ana, CA) after adding ∼0.3 g of acid-washed glass beads (Sigma-Aldrich). The homogenate was clarified at 13,000 rpm for 15 min at 4ºC and at 50,000 rpm for 30 min at 4ºC. The supernatant was incubated with 25 μl of bed volume PLP-Sepharose beads and a range of concentrations of purified recombinant profilin for 2 h at 4ºC. Beads were collected, washed three times, boiled in protein sample buffer, and run on a 15% SDS–PAGE gel. Western Blot confirmed the actin band with an anti–β-actin antibody (Santa Cruz Biotechnology, Dallas, TX).
6
Purification of GST-tagged Recombinant Proteins
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
GST-tagged recombinant proteins were expressed in E. coli BL21 transformed with pGEX-3X fusion constructs. For each protein, an aliquot of an overnight pre-culture was used to inoculate a fresh complex medium (LB) containing 50 μg/ml Ampicillin (Serva) and maintained at 37 °C up to mid-log phase (A600 = 0.4–0.6). Cultures were then incubated at 30 °C for 3 h with IPTG (1 mM) for induction. Bacterial cells were harvested and washed twice in cold PBS, before being resuspended in PBS (replaced by distilled water when samples were prepared for insect bioassays) and added with 1 ml acid-washed glass beads (710–1180 μm) (Sigma-Aldrich) for cell breaking through 5 cycles of vortexing (20 s at 100 W) and cooling in ice (20 s). Lysates were then centrifuged at 5,000 rpm for 30 min at 4 °C, and the resulting pellets and supernatants were stored at −20 °C for further use, after being quantified for protein content by Bio-rad Protein assay (Bio-rad).
GST-tagged proteins were purified from lysates following the Glutathione Sepharose 4 Fast Flow one-step protocol (GE Healthcare) according to manufacturer’s instructions, which allowed to collect different protein eluates.
The result of each expression and purification step was checked by SDS-PAGE or Western Blot analysis.
GST-tagged proteins were purified from lysates following the Glutathione Sepharose 4 Fast Flow one-step protocol (GE Healthcare) according to manufacturer’s instructions, which allowed to collect different protein eluates.
The result of each expression and purification step was checked by SDS-PAGE or Western Blot analysis.
7
Cloning and Analyzing Mpr1 Protein
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
ScWT and ScMPR1> were cultured overnight at 30°C in yeast extract-peptone dextrose (YPD) and uracil dropout media respectively. The yeasts cells (~5 × 107 cells) were harvested and lysed with acid-washed glass beads (425–600 μm acid-washed glass beads; Sigma-Aldrich, Saint Louis, MO, USA). RNA was isolated according to the manufacturer instruction (RNeasy Mini Kit; QIAGEN, Valencia, CA, USA), and cDNAs were synthesized using the first-strand cDNA kit (SuperScript III First-Strand Synthesis System; Invitrogen Life Technologies, Carlsbad, CA, USA). The cDNAs were used as templates for PCR reactions with the following primers: for Mpr16XHIS, forward primer 5′ ATGCGCTCCTCCGCGCTCATC 3′ and reverse primer 5′ TCAATGGTGATGGTGATGATGTCTAGAAGATTTGG 3′; for actin (internal control), forward primer 5′ ATGGAAGAAGAAGTCGCCGCCTTGG 3′, and reverse primer 5′ TTAGAAACACTTTCGGTGGACGATTG 3′.
8
Sup35 Protein Purification from Yeast
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
His-tagged Sup35 was expressed in BL21 (DE3) cells and partially purified as described above, but retained bound to the nickel resin. Yeast cultures were grown to mid-log phase and mechanically lysed with acid-washed glass beads (Sigma) in Sup35 binding buffer + protease inhibitors (20 mM Tris, 0.5 M NaCl, 5 mM imidazole, 2 M urea, 0.1% IGEPAL, 50 mM NEM, 3 mM PMSF, 1 tablet Roche Protease Inhibitor Cocktail #4693159001). Cleared lysates were incubated for 30 minutes with the Sup35-bound nickel resin prior to washing with 150 mL washing buffer (20 mM Tris-HCl, 0.5 M NaCl, 20 mM imidazole, 2 M urea) and elution with 100 mL elution buffer (20 mM Tris-HCl, 0.5 M NaCl, 400 mM imidazole, 2 M urea). Fraction collection was followed by standard SDS-PAGE (10% polyacrylamide) and western blotting.
9
Immunoblotting Analysis of yTdp1 Protein
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Immunoblotting was performed as described in Gajewski et al.21 (link). Briefly, we used anti-yTdp18 (link), anti-Histone H3 (Abcam), and anti-GAPDH (Gentex) antibodies. Transformed yeast cells with the indicated vectors were grown in selective media supplemented with 2% dextrose the first night, then 1/100 diluted into selective media supplemented with 2% raffinose. Raffinose cultures were induced for 6 h with 2% galactose, corrected to the same OD600 and lysed with acid-washed glass beads (Sigma) at 4 °C in 50 mM Tris pH 8.0, 2 mM EDTA, 2 mM EGTA, 1 mM PMSF, 10% glycerol and Complete EDTA-free Protease Inhibitor (Roche). Lysate protein concentrations were determined by Bradford-assay (Bio Rad). Lysates were boiled in SDS buffer for 10 min and samples were loaded onto a 10% Bis–Tris PAGE in SDS buffer, blotted onto PVDF and immunostained with anti-yTdp1, stripped (62.5 mM Tris, 2% SDS and 0.8% β-mercaptoethanol) and reprobed with anti-GAPDH or anti-Histone H3 antibodies. Immunostaining was visualized by chemiluminescence using a G:Box imager and the accompanied GeneSynV1.6.1.0 software (Syngene). For presentation, orientation, and intensities (by correcting brightness and contrast) of whole gel images were modified in Adobe Photoshop before cropping and figures were finalized (adjusted in size) in Adobe Illustrator.
10
RNA Extraction and RT-qPCR Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA was extracted as follows: Frozen cells (~24 OD600) were disrupted by vortexing in 600 μl AE buffer (50 mM sodium acetate, 10 mM EDTA, 1% SDS) and 600 μl acid phenol (Fisher Scientific) in the presence of ~100 μl acid-washed glass beads (Sigma) at 4 °C for 5 min. RNA was extracted by incubation in phenol at 65 °C for 10 min. Next, cells were vortexed again as before, incubated at 65 °C for 10 min, vortexed, and spun down at 18,400 × g for 10 min at 4 °C. The aqueous top phase was transferred to a new tube and extracted again in phenol. After another spin down and transfer to a new tube, RNA was extracted in 400 μl chloroform followed by ethanol precipitation. cDNA was made with SuperScript III (Life Technologies) using random hexamers or gene-specific primers from 1 μg of total RNA. RT-pPCR was performed using SYBR green PCR master mix (Life Technologies) with primers listed in Supplementary Table 2 on Applied Biosystem 7500 or QuantStudio 5 instruments.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!