Zirconia beads

Seedlings were removed from conetainers or conical tubes and shaken gently to remove loosely-attached soil from the roots. Approximately 5 g of roots were cut into 2–3 cm-long pieces and collected in a 7 ml plastic vial (BioSpec Products Inc, Bartlesville, OK) with 1.5–2 g of 2 mm Zirconia beads (BioSpec Products Inc, Bartlesville, OK). An aliquot of 2 ml of sterile water was added to each vial containing roots and Zirconia beads, secured in a Mini-BeadBeater-96 (BioSpec Products Inc, Bartlesville, OK), and shaken at 2,400 oscillations/min for 5 minutes. Beadbeated vials were then briefly centrifuged at 1,500 rpm for 1 second in an Eppendorf 5810R centrifuge (Eppendorf-Netheler-Hinz GmbH, Barkhausenweg, Germany). An aliquot of 200 μl of the supernatant was transferred to a ZR BashingBead Lysis Tube from ZR Soil Microbe DNA miniprep kit (Zymo Research Corporation, Irvine, CA) and bacterial DNA was extracted following manufacturer’s instructions. Quick-DNA™ Fungal/Bacterial Miniprep Kit (Zymo Research Corporation, Irvine, CA) was used to extract DNA from batch cultures.

Synchronised animals were grown in liquid culture under standard conditions using HB101 as food source at 20°C and collected as young adults to gravid animals. Bacteria were washed off by several washes with M9. Animals were washed and transferred into lysis buffer (20 mM Tris/Cl, ph 8.0, 140 mM KCl, 1.8 mM MgCl2, 0.5% NP-40, 1 mM DTT, 0.1 mM PMSF, Protease Inhibitor Cocktail). A 1:1 slurry of animals in lysis buffer was snap frozen in liquid nitrogen, thawed and homogenized using 0.7mm diameter Zirconia beads (BioSpec products) in a Precellys 24 homogenizer (Bertin Technologies) at 6500 rpm for 2x 20 seconds.
Cell debris was removed by centrifugation and 20 mg of cleared extracts was subjected to HRDE-1 immunoprecipitation using 2.5 μg anti-HRDE-1 polyclonal antibodies [3 (link)]. Antibody-antigen complexes were recovered using Dynabeads Protein A (Life Technologies). 5% of immune-precipitated material was subjected to SDS-PAGE followed by Western Blotting with anti-HRDE-1 and anti-PRG-1 antibodies [34 (link)]. The remaining antibody-antigen complexes were eluted from the Dynabeads by adding 1ml TRIsure reagent (Bioline) to extract RNA. After snap-freezing in liquid Nitrogen, samples were processed according to the manufacturer’s protocol.

Sewing overlap extension PCR (56 (link)) was used to introduce mutations into Mtb mpa. We made a new mpa complementation plasmid with WT mpa (pHD300) to be isogenic to the constructs with introduced mutations. The primers used to amplify WT mpa (pHD300) were KpnImpa_pF: TAGGTACCCCACTACGCCTGTGGCTAGG and mpaH3R: TGAAGCTTCTACAGGTACTGGCCGAGGTTG (28 (link)). For “LV > SS” (pHD301) and “ΔEVE” (pHD302), we used MpaLV_SS_SOEF (GCCGAGGTAGAAGACTCGAGCCTGGAAGAGGTGCCG), MpaLV_SS_SOER (cGGCACCTCTTCCAGGCTCGAGTCTTCTACCTCGGC), MpaEVE_SOEF (CGCATCCCCAAAGCCGACCTGGTGCTGGAAG), and MpaEVE_SOER (CTTCCAGCACCAGGTCGGCTTTGGGGATGCG). All products were cloned into pMV306, which integrates at an attB site on the Mtb chromosome and used to transform MHD5, an mpa::MycoMarT7 null mutant (4 (link)).
Bacteria were grown in Middlebrook 7H9 medium to an absorbance at 580 nm of 1.7. Five absorbance-equivalent cell numbers were collected by centrifugation, washed in phosphate-buffered saline with Tween-80, and lysed in Tris–EDTA buffer using zirconia beads in a bead beater (Bio-Spec, Inc). Cell lysates were transferred to fresh tubes with SDS protein sample buffer and boiled for 10 min at 100 °C before removing them from the Biosafety Level 3 facility. Immunoblotting was done with antibodies to FabD–His₆ and Mpa–His₆, as previously described (57 (link)).

The C57BL/6 mice used in this study were either from a colony of mice originally purchased from The Jackson Laboratory (Bar Harbor, ME) and maintained at the Rocky Mountain Laboratories or purchased from The Jackson Laboratory and used shortly after arrival. Animal facilities maintained the following parameters: temperature, 72 ± 3°F; humidity, 50 ± 10%; dark/light cycle, 12:12 h.
For  oral infection, mice were streptomycin treated 24 h before infection, using a blunt end gavage needle with 100 µl SPGS containing 200 mg/mL streptomycin. Mice were fasted for 4 h prior to all gavages. Mice were gavaged or infected intraveneously by retroorbital injection with a volume of 100 µl. Mice were euthanized by isoflurane inhalation followed by exsanguination. Tissues were collected in screwcap tubes containing 500 µl SPGS and 3–4 2.0 mm zirconia beads (BioSpec Products) and homogenized using a Bead Mill 24 (Fisher Scientific, 4.85 m/s for 20 s). Tubes were weighed before and after organ collection. CFUs were estimated by 10 µl spot plating of 10-fold dilutions on LB agar plates containing the appropriate antibiotic.

Samples for RNA extraction were thawed and mixed with 0.5 cm³ of 2.0 mm Zirconia Beads (Biospec). Tissue was homogenized using the Precellys 24, Cryolys system (Bertin Technologies) with the following settings: 3 cycles at 6800rpm, with 30s of alternate run and pause time, program was carried out twice. Homogenate was transferred to a clean 2 mL Eppendorf tube and total RNA was isolated as described above.

Replicating (i.e. with STR) or STR-starved M. tuberculosis 18b cultures (40 ml) were pelleted and cells flash frozen in liquid nitrogen and stored at −80 °C until use. Bacteria were re-suspended in 1 ml Trizol (Invitrogen) and added to a 2-ml screw-cap tube containing 0.5 ml zirconia beads (BioSpec Products). Cells were disrupted by bead-beating twice for 1 min with a 2-min interval on ice. The cell suspension was then transferred to a new tube, where chloroform-isoamylalcohol (24:1) extraction was performed. RNA was precipitated by adding 1/10 volume of sodium acetate (2 M, pH 5.2) and 0.7 volume of isopropanol, washed with 70 % ethanol, air-dried and resuspended in DEPC-treated water. DNase treatment was carried out twice using RQ1 RNase-free DNase (Promega), following the manufacturer’s recommendations, and the reactions were subsequently cleaned up by phenol-chloroform extraction and ethanol precipitation. RNA was stored at −80 °C in DEPC-treated water. Amount and purity of RNA were determined spectrophotometrically and by Qubit analysis (Life Technologies), integrity of RNA was assessed on 1 % agarose gel and by Fragment Analyzer (Advanced Analytical).