Mouse SETDB1 iKO-ES cells were treated with Tam for 3 d. Cells were then treated with fresh culture medium containing 1% formaldehyde for 10 min and washed twice with ice-cold PBS containing protease inhibitors. Cell pellets were resuspended in SDS lysis buffer also containing protease inhibitors (200 µL lysis buffer for every 1 × 106 cells) and incubated on ice for 10 min. Cell lysate was sonicated (15 W for 10 sec, six times) to shear DNA to lengths between 100 and 500 bp. Subsequently, ChIP was performed according to the ChIP assay kit (Millipore17-295) instructions using antibodies against SETDB1 (Santa Cruz, no. 66884), EZH2 (Millipore, no. 17-662), H3K27me3 (Millipore, no. 07-449), and H3K9me3 (Active Motif, no. 39161). Eluted DNA was used for PCR, qPCR, or deep sequencing. For ChIP-qPCR analysis, the relative binding level of each gene was normalized against input. Primer sequences are listed in Supplemental Table S2. For ChIP-seq libraries, 10 ng of input chromatin DNA or ChIP DNA was processed using the ChIP-seq sample prep kit (Illumina). Gel-purified ChIP-seq library DNA was further purified by phenol-chloroform extraction and ethanol precipitation and was processed for cluster generation, 15-cycle sequencing, and sequence analysis using Illumina HiSeq. The summary of generated ChIP-seq data sets is listed in Supplemental Table S3.
H3k9me3
Manufactured by Active Motif
Sourced in United States
H3K9me3 is a histone modification that marks trimethylation of lysine 9 on histone H3. It is a widely studied epigenetic mark associated with heterochromatin and gene silencing.
Automatically generated - may contain errors
Lab products found in correlation
H3k27me3, by Active Motif (13 mentions)
H3k4me3, by Active Motif (9 mentions)
H3k27me3, by Merck Group (8 mentions)
H3k36me3, by Active Motif (3 mentions)
H3k36me3, by Abcam (3 mentions)
H3k9me2, by Active Motif (3 mentions)
H3k9me1, by Active Motif (3 mentions)
H3k4me3, by Merck Group (3 mentions)
H3k4me2, by Active Motif (2 mentions)
H3k27ac, by Abcam (2 mentions)
H3k4me2, by Cell Signaling Technology (2 mentions)
H3k4me1, by Cell Signaling Technology (2 mentions)
H3k27ac, by Active Motif (2 mentions)
H3k9ac, by Active Motif (2 mentions)
H3k27me3, by Diagenode (2 mentions)
β actin, by Cell Signaling Technology (2 mentions)
Protease inhibitor cocktail, by Roche (2 mentions)
Histone h3, by Abcam (2 mentions)
H3k4me1, by Merck Group (2 mentions)
H4k20me3, by Merck Group (2 mentions)
35 protocols using h3k9me3
1
ChIP-seq Analysis of Setdb1 in Mouse ES Cells
2
Chromatin Immunoprecipitation of Engineered ESCs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Nm dCas9-effector ESCs transduced with lentivirus containing an sgRNA were plated onto 0.1% gelatin coated plates at 5×104 cells/cm2 in 2i media. After 48 hours, cells were passaged and plated in 2i media supplemented with 1μM puromycin. Cells were maintained in 2i media with 1μM puromycin and harvested 9 days later. Cells were crosslinked with fixing solution ((11% formaldehyde, 100 mM NaCl, 1 mM EDTA, 50 mM HEPES-KOH [pH 7.6]) and incubated for 10 minutes at room temperature. The crosslinking reaction was stopped by the addition of glycine to 125mM. Cells were washed once with PBS, pelleted, frozen and stored at −80°C. Chromatin immunoprecipitation (ChIP) was performed as described30 . 10×106 cells and 50μL of antibody-coupled protein A magnetic beads (NEB) were used for each ChIP. Protein A magnetic beads were coupled to either H3K4Me2 (Active Motif, 39141), H3 (Abcam, ab1791), H3K27Me3 (Millipore, 07-449), H3K9Me3 (Active Motif, 39161) or H3K27Ac (Abcam, ab4729) antibodies. ChIP and input samples were used as a template for qPCR analysis using SYBR FAST (KAPA Biosystems, KK4602) with the primers listed in Supplementary Table 7
3
Antibody Detection Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The antibodies used in these studies were mostly purchased from commercial sources. These included antibodies recognizing a Myc-tag (Cell Signalling), H3K9me3 (Active Motif), and H4K20me3 (Abcam). The VACV I3L 10D11 monoclonal antibody was from laboratory stocks. The Alexa-fluor 488 and Cy-5 conjugated secondary antibodies were purchased from Molecular Probes.
4
Histone Modification Analysis by Western Blot
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
After treatment, the cells were washed with PBS and lysed with radioimmunoprecipitation assay (RIPA) buffer buffer containing phosphatase and protease inhibitors. Cell lysates were resuspended in Laemmli SDS sample buffer (60 mM Tris–HCl, 1% SDS, 10% glycerol, 0.05% bromophenol blue, pH 6.8, and 2% β-mercaptoethanol) and then subjected to 10% SDS–PAGE. The gels were then transferred to polyvinylidene difluoride (PVDF) membrane for immunoblot. Membranes were then blocked in 5% non-fat skim milk for 1 h and then incubated with primary antibody at 4° overnight. Primary antibodies directed against H3K4me3 (Cat. no. 39915; Active Motif), H3K4me2 (Cat. no. 9725; Cell Signaling), H3K4me1 (Cat. no. 9723; Cell Signaling), H3K9me3 (Cat. no. 39161; Active Motif), H3K27me3 (Cat. no. 39156; Active Motif), H3K36me3 (Cat. no. 61101; Active Motif), and H3 total (Cat. no. 39763; Active Motif) were used. Membranes were then washed three times before incubating with peroxidase-conjugated secondary antibody. Protein bands were detected using a chemiluminescence kit (Millipore).
5
Epifluorescence Imaging of Histone Modifications
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For standard epifluorescence imaging of histone post-translational modifications, after blocking with BSA and Click reaction for EdU labeling, coverslips were incubated with primary and secondary antibodies and stained with DAPI. Coverslips were mounted in Vectashield medium. We used an AxioImager Zeiss Z1 microscope with a 63× objective. For confocal images, we used a Confocal Zeiss LSM780, and images were acquired using 63×/1.4NA under Zen blue software (Zeiss Germany). Antibodies were used at the following dilutions: H3K9me3 1:1000 (39765, ActiveMotif), H3K27me3 1:500 (07-449, Millipore), H3K4me3 1:500 (07-473, Millipore), H3K36me3 1:500 (ab9050, Abcam) and γH2AX 1:1000 (05-636, Euromedex).
6
ChIP-qPCR Analysis of Histone Modifications
7
ChIP-seq of Muscle Cell Regulators
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Formaldehyde (1%, 10 min) fixed cells were sheared to achieve chromatin fragmented to a range of 200–700 bp using an Active Motif EpiShear Sonicator. Chromatin samples were immunoprecipitated overnight at 4°C with antibodies targeting MYOD (CST, cat#13812S), H3K27ac (Active Motif, #39133), CTCF (Millipore, #07-729) and H3K9me3 (Active Motif, #39062). DNA purifications were performed with the modified ChIP protocol described previously (33 (link)). For sample normalization, 2 million C2C12 cells were added to 6 million RMS cells before sonication. ChIP-seq libraries were prepared using Illumina indexes and adaptors as described previously (31 (link)). Libraries were multiplexed and sequenced using the NextSeq500 (Illumina).
8
Chromatin Immunoprecipitation and Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Chromatin isolation and chromatin immunoprecipitation (ChIP) analyses were carried out as described [42 (link)]. Antibodies used for ChIP were directed against H2A.Zac (Diagenode, Liège, Belgium), H3K4me1 (Diagenode, Liège, Belgium), H3K4me3 (Diagenode, Liège, Belgium), H3K9ac (Active Motif, Carlsbad, CA, USA), H3K9me3 (Active Motif, Carlsbad, CA, USA), H3K9me3S10ph (Diagenode, Liège, Belgium) or H3K27me3 (Active Motif, Carlsbad, CA, USA). Relative enrichment of precipitated sequences in ChIP was assessed using qPCR.
9
Chromatin Immunoprecipitation of H3K9me3 and H3K27me3
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
ChIP assays were performed as described before [30 (link)]. In brief, after crosslinking with formaldehyde, cells were lysed and chromatin was harvested and fragmented by micrococcal nuclease digestion (5,000U/sample for 20 min). The chromatin was then subjected to the immunoprecipitation using H3K9me3 (Active Motif) and H3K27me3 (Abcam) antibodies followed by DNA purification. Histone H3 antibody was used as positive control. Primers sequences used for amplifying ChIP products are: EGFR, Forward: 5' GGACACTTAGCCTCTCTAAA 3', and Reverse: 5' GGGAAACTGCTCCTTTATTC 3'; H-Ras, Forward: 5' CAGATTGAAGGATGCCTAGA 3', and Reverse: 5' GCATCTCCTAATCTCCTCTG 3'. Normalized Ct (ΔCt) values were calculated by substracting the Ct obtained with input DNA from that obtained with immunoprecipitated DNA (ΔCt=Ct (IP)-Ct (Input)). Relative fold enrichment of H3K9me3 or H3K27me3 at the target site was then calculated using percent of positive control. Changes related to expression of wild type IDH1 or IDH1- R132H mutant was then represented by fold change relative to cells infected with empty vector.
10
Immunofluorescence Staining of Neural Markers
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Immunofluorescence was performed following standard procedures. Briefly, cells were permeabilized for 10 min in 0.2% Triton X-100 in PBS after fixation. Then cells were blocked with 2.5% BSA in PBS for 30 min at room temperature and incubated with primary antibody overnight at 4°C. Primary antibodies used in the studies were NESTIN (1:100; Millipore, no. IHCR1006-6), TUJ1 (1:200; Sigma, no. T2200), and H3K9me3 (1:500; Active Motif, no. 39161). After washing, cells were incubated with the appropriate secondary antibodies conjugated with Alexa546 (1:1000; Invitrogen, no. A11035) or Alexa488 (1:1000; Invitrogen, no. A21202) for 1 h at room temperature. Cell nuclei were labeled by DAPI staining (0.5 μg/mL; Sigma). Cells were then washed in PBS and mounted for examination under a fluorescence microscope.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!