Maxima qpcr master mix

Total RNA was isolated from IMR-32 and SH-SY5Y cells using the GeneJet RNA Purification Kit (Thermo Scientific, Waltham, MA, USA) according to the manufacturer’s instructions. RNA was reverse transcribed using the Maxima First Strand cDNA Synthesis Kit for RT-PCR (Thermo Scientific) and qPCR performed using Maxima qPCR Master Mix. Sequences of primers were as follows: ALK forward primer: 5′-GTGCCATGCTGCCAGTTAAG-3′, ALK reverse primer: 5′-TGGTTGCTTTTGCTGGGGTA-3′; MDK forward primer: 5′-AAGGAGTTTGGAGCCGACTG-3, MDK reverse primer: 5-CATTGTAGCGCGCCTTCTTC-3′. Amplification of GAPDH was used as a normalization control for total RNA input. Relative expression of ALK and MDK were determined using the dCq method.

RNA was isolated by column purification (RNeasy Kit, Qiagen) and cDNA synthesis was performed by reverse transcription of 1 µg of total RNA by reverse transcriptase (Superscript III, 18080044, Invitrogen) in a reaction containing 1 µl RNase OUT (10777019, Invitrogen). qPCR was performed on cDNA using SYBR green quantification (Maxima qPCR master mix, K0222, Thermo Fisher). ABCB7, ISCU and FXN expression was quantified relative to ACTB, MOCS3, NFS1, ENO2, and SLC2A3 were quantified relative to RPL13A using the following primers: ABCB7 forward: GCAGTCACACGGTGGAGAACT, ABCB7 reverse: TTGACCAAAGTTCAGCATAGCC; ACTB forward: AAGGGACTTCC TGTAACAATGCA, ACTB reverse: CTGGAACGGTGAAGGTGACA; ISCU forward: CCAGCATGTGGTGACGTAATG, ISCU reverse: AGCTCCTTGGCG ATATCTGTG; FXN forward: CTTGCAGACAAGCCATACACG, FXN reverse: ACACCCAGTTTTTCCCAGTCC; NFS1 forward: CACTCCCGGACACA TGCTTAT, NFS1 reverse: TGTCTGGGTGGTGATCAAGTG; SLC2A3 forward: AGTCATGATCCCAGCGAGAC, SLC2A3 reverse: GCCGATTGTAGCAA CTGTGA; ENO2 forward: AGCTGGCCATGCAGGAGTTC, ENO2 reverse: GGCTTCCTTCACCAGCTCCA; MOCS3 forward: CGCTCCCTGCAAC TACTGA, MOCS3 reverse: CAGTCGCTTATAGTCGGTGACA; RPL13A forward: CATAGGAAGCTGGGAGCAAG, RPL13A reverse: GCCCTCCAATCAGTCTTCTG

Total RNA was isolated from tissue using the GeneJet RNA Purification Kit (Thermo Scientific, Schaumburg, IL, USA) according to the manufacturer's instructions. RNA was reverse transcribed using the Maxima First Strand cDNA Synthesis Kit (Thermo Scientific) and qPCR was performed using Maxima qPCR Master Mix (Thermo Scientific). Sequences of primers were as follows: aggrecan (Acan) forward primer: 5’-CGTTGCAGACCAGGAGCAAT-3’, Acan reverse primer, 5’-CGGTCATGAAAGTGGCGGTA-3’; brevican (Bcan) forward primer: 5’- TTTTGTGAGGCTCCCGGC-3’, Bcan reverse primer: 5’- GGAAGAACTTGCGAGGTCCC-3; phosphacan (Ptprz1) was detected with a pre-designed TaqMan® gene expression assay from Life Technologies (Grand Island, NY, USA). Amplification of β-actin (Actb) was used as a normalization control for total RNA input. Relative expression levels of Acan, Bcan and Ptprz1 were calculated using the dCq method.