Total RNA was extracted using TRIzol reagent (Invitrogen) and quantified at NanoDrop-1000 (Thermo Fisher Scientific, Inc) based on the manufacturer’s instructions. One Step PrimeScript miRNA complementary DNA (cDNA) Synthesis Kit (Takara, Dalian, China) was used to reverse transcribe the extracted RNA into cDNA. The RT-qPCR was conducted at ABI 7500 system (Applied Biosystems, Foster City, California) with the following procedures: 1 cycle of 95°C for 10 minutes; followed by 40 cycles of 95°C for 10 seconds, 60°C for 20 seconds, and 70°C for 30 seconds. Primer sequences were used as follows: miR-376c-3p forward: 5′-GTGCAGGGTCCGAGGT-3′ and reverse: 5′-ATCATAGAGGAAAATCCACG-3′; U6 snRNA forward: 5′-CTCGCTTCGGCAGCACA-3′ and reverse: 5′-AACGCTTCACGAATTTGCGT-3′. Relative expression levels were calculated using 2−ΔΔCt method using U6 small nuclear RNA as control. Assays were conducted in triplicates.
One step primescript mirna complementary dna cdna synthesis kit
Manufactured by Takara Bio
Sourced in China
The One Step PrimeScript miRNA complementary DNA (cDNA) Synthesis Kit is a laboratory equipment product designed for the reverse transcription of microRNA (miRNA) into cDNA. It provides a streamlined, single-step process for the synthesis of high-quality cDNA from miRNA samples.
Automatically generated - may contain errors
Lab products found in correlation
Trizol reagent, by Thermo Fisher Scientific (3 mentions)
Sybr premix ex taq 2 kit, by Takara Bio (2 mentions)
Nanodrop 1000, by Thermo Fisher Scientific (1 mentions)
Abi 7500 system, by Thermo Fisher Scientific (1 mentions)
Primescript rt kit, by Takara Bio (1 mentions)
Abi 7500 fast real time pcr system, by Thermo Fisher Scientific (1 mentions)
Hifiscript cdna synthesis kit, by CWBIO (1 mentions)
3 protocols using one step primescript mirna complementary dna cdna synthesis kit
1
miR-376c-3p Expression Analysis
2
Quantifying Circular RNA and miRNA in Osteosarcoma
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The total RNA of OS cells and tissues was extracted utilizing TRIzol reagent (Invitrogen, Carlsbad, CA, USA). The Cytoplasmic & Nuclear RNA Purification Kit (Amyjet, Wuhan, China) was used to extract RNA from the nucleus or cytoplasm of OS cells, respectively. The PrimeScript RT kit and the One Step PrimeScript miRNA complementary DNA (cDNA) synthesis kit (Takara, Tokyo, Japan) were employed for the reverse transcription of the RNA into cDNA. Using the SYBR PremixEx Taq II kit (Takara, Tokyo, Japan), qRT-PCR was performed on the ABI 7500 Fast Real-Time PCR System (Applied Biosystems, Foster City, CA, USA). The 2−ΔΔCt method was employed for calculating the relative expression of target genes in each experimental group, with U6 and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) as the internal references [20 (link)]. Table 1 shows the primer sequences.
Primers used for qRT-PCR.
| Name | Sequence (5’-3’) |
|---|---|
| circ_0078767 | F: TGCCTAGCTGTCAAGGAGTG |
| circ_0078767 | R: GGATCTAGAGATGCGCCAACA |
| GAPDH | F: TGGTATCGTGGAAGGACTC |
| GAPDH | R: AGTAGAGGCAGGGATGATG |
| KLF9 | F: ACAGTGGCTGTGGGAAAGTC |
| KLF9 | R: TCACAAAGCGTTGGCCAGCG |
| miR-889 | F: ACACTCCAGCTGGGTTAATATCGGACAAC |
| miR-889 | R: TGGTGTCGTGGAGTCG |
| U6 | F: CTCGCTTCGGCAGCACA |
| U6 | R: AACGCTTCACGAATTTGCGT |
F, forward; R, reverse.
3
Quantification of miR-132-3p and KIF21B Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA sample was extracted from tissue specimens or cell lines using TRIzol reagent (Invitrogen). Reverse transcription was conducted by One Step PrimeScript miRNA complementary DNA (cDNA) Synthesis Kit (Takara, Dalian, China) for miR-132-3p and a HiFiScript cDNA Synthesis Kit (CWBIO, Beijing, China) for KIF21B. Next, reverse transcription quantitative PCR was performed to determine the expression of miR-132-3p and KIF21B using SYBR Green Human miRNA Assay Kit and a SYBR Premix Ex Taq II kit (Takara, Japan), respectively. The primer sequences were used as follows: miR-132-3p (forward: 5ʹ-GCGCGCGTAACAGTCTACAGG-3ʹ and reverse: 5ʹ-GTCGTATCCAGTGCAGGGTCC-3ʹ); U6 (forward: 5ʹ-CTCGCTTCGGCAGCACATATACT-3ʹ and reverse: 5ʹ-CGCTTCACGAATTTGCGTGT-3ʹ); KIF21B (forward: 5′-CGA GGAGACGGATGAGAACG-3′ and reverse, 5′-CCACCAGGCTCTCTTCACTG-3′); β-actin (forward: 5′-CCCGAGCCGTGTTTCCT-3′ and reverse: 5′-GTCCCAGTTGGT GACGATGC-3′). Relative miR-132-3p and KIF21B mRNA expression were normalized against the endogenous control U6 and β-actin, respectively, using the 2− ΔΔCt method [33 ].
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!