A total of 19 phages representing each genome size group, but from different lysis groups and sources were selected for restriction enzyme analysis. DNA of the induced phages was extracted by phenol/chloroform as described previously [26 (link)]. Restriction analysis was performed using Fast digest HindIII (Thermo Fisher Scientific, MA, USA) and EcoRI (Vivantis, Selangor Darul Ehsan, Malaysia), following the manufacturers’ instructions. Two restriction profiles were considered different when at least one distinguishing band was present [32 (link)].
Fastdigest hindiii
Manufactured by Thermo Fisher Scientific
Sourced in United States
FastDigest HindIII is a restriction enzyme that cleaves DNA at the recognition sequence 5'-A^AGCTT-3'. It is a fast-acting enzyme designed to deliver complete digestion in a short incubation time. FastDigest HindIII is suitable for a variety of molecular biology applications, including DNA cloning, analysis, and mapping.
Automatically generated - may contain errors
Lab products found in correlation
Fastdigest ecori, by Thermo Fisher Scientific (2 mentions)
Poly d lysine hydrobromide, by Merck Group (2 mentions)
Mgso4, by Merck Group (2 mentions)
Cacl2, by Merck Group (2 mentions)
Phenol red free neurobasal medium, by Thermo Fisher Scientific (2 mentions)
Geneticin g418 sulfate, by Corning (2 mentions)
Lipofectamine 2000, by Thermo Fisher Scientific (2 mentions)
Penicillin streptomycin, by Merck Group (2 mentions)
Poly d lysine, by Merck Group (2 mentions)
Fugene hd transfection reagent, by Promega (2 mentions)
Glutamax, by Thermo Fisher Scientific (2 mentions)
Fetal bovine serum (fbs), by Merck Group (2 mentions)
Sodium chloride (nacl), by Merck Group (2 mentions)
Sodium hydroxide (naoh), by Merck Group (2 mentions)
Potassium chloride (kcl), by Merck Group (2 mentions)
Sucrose, by Merck Group (2 mentions)
Ethylene glycol tetraacetic acid (egta), by Merck Group (2 mentions)
Hepes, by Merck Group (2 mentions)
Glutamine, by Merck Group (2 mentions)
Mgcl2, by Merck Group (2 mentions)
13 protocols using fastdigest hindiii
1
Phage Genome Size Restriction Analysis
2
Metagenomic DNA Plasmid Construction
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The plasmids were prepared by amplifying the gene encoding the metagenomic DNA of the samples extracted for the sequences available in the LBMP55 . The following specific primers (Sigma-Aldrich) were synthesized using the commercial PCRBIO Ultra Mix 2 × Kit26 (link): forward 5'-TATAgaattcTTCGGACGCAATCCAGACACCAATCC-3', which contains the restriction site EcoRI, and reverse 3'-TATAaagcttTTACTTGAACAGCAATTGAG-5', which contains the restriction sites EcoRI and HindIII. The fragment corresponding to the gene was purified by the Zymoclean Gel DNA Recovery Kit from ZymoResearch. The vector pET28a ( +) (INVITROGEN) and insert were restricted with restriction enzymes (FastDigest EcoRI, Thermo Scientific; and FastDigest HindIII, Thermo Scientific) and dephosphorylated with the enzyme Fast Alkaline Phosphatase (1 U/µL, Thermo Scientific). The connection between the insert and the vector was performed according to the protocol of Sambrook and Russel56 (link) using the T4 DNA ligase enzyme (New England Biolabs) in a 3:1 ratio (insert: vector).
3
High-Fidelity Cloning of SARS-CoV-2 RdRp
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The 119 nt target RdRp sequence was amplified using high-fidelity DNA polymerase and Phusion Plus PCR Master Mix (Thermo Fisher Scientific, Waltham, MA, USA) to ensure high accuracy during DNA synthesis, and amplicons were purified using a QIAquick PCR Purification Kit (Qiagen, Germantown, MD, USA). Purified amplicons (1 µg) and 5 µg of pcDNA 3.1 vector (Invitrogen, Waltham, MA, USA) were cleaved using FastDigest HindIII and EcoRI (Thermo Fisher Scientific) according to the manufacturer’s instructions. Products were separated on a 1.5% agarose gel (110 V, 40 min, room temperature), excised, and purified using a QIAEX II Gel Extraction Kit (Qiagen). Ligation was performed overnight at 4 °C using T4 DNA ligase (Roche, Grenzach-Wyhlen, Germany) at a 1:3 molar ratio of vector to insert.
4
Genomic DNA Extraction and Fragmentation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The genomic DNA (gDNA) was extracted with phenol:chloroform from HepG2 cells. For tagmentation, 50 ng of gDNA was tagmented in a 30-μL reaction containing 1 × Tn5 transposome reaction buffer (LM buffer), 3 μL Dimethylformamide (DMF) (Sigma) and 4 μL Tn5 transposome at 55 °C for 15 min. The tagmented gDNA was purified with the MinElute PCR Purification Kit (QIAGEN, 28004). For Hind III digestion, 1 μg of DNA was digested in a 50-μL reaction containing 1× FastDigst Buffer and 5 μL FastDigest Hind III (Thermo Fisher, ER0501) at 37 °C overnight. For sonication, 1 μg of gDNA was sonicated by using the BRANSON sonicator with 70% power, 20s on and 20 s off for 20 cycles. The fragmented gDNAs were denatured at 95 °C for 5 min and chilled on ice for 5 min, which was then run with 1.5% agarose gel. The gDNA fragments of 200–1000 bp were recovered with the QIAquick Gel Extraction Kit (Qiagen, 28704).
5
Quantification of mtDNA by ddPCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total DNA was extracted from cells by DNeasy Blood & Tissue Kit (QIAGEN, Hilden, Germany) following the manufacturer’s instruction, and the amount of DNA was quantified using the NanoDrop ND-1000 (Thermo Fisher Scientific, Inc.). Then, 10 µL of DNA were digested using FastDigest HindIII (Thermo Fisher Scientific, Inc.).
The amount of mtDNA was quantified by ddPCR. The reaction mixture of ddPCR had this composition in 20 µL of the final volume: 10 ng of DNA samples, 2X ddPCR Supermix for Probes (Bio-Rad Laboratories), and 1.1 µL of each isoform custom assay (Bio-Rad Laboratories). The thermal protocol conditions were: 95 °C for 10 min, followed by 40 cycles of 94 °C for 30 s, and 55 °C for 1 min, then 98 °C for 10 min. Droplet reading was performed on a QX200 ddPCR droplet reader (Bio-Rad laboratories). Analysis was performed using QuantaSoft Analysis software (version 1.7.4.0917, Bio-Rad laboratories). The following wet-validated primers were used: ND2 (Bio-Rad, Hercules, CA, USA, #10031252) and Actb (Bio-Rad, Hercules, CA, USA, #10042961).
The amount of mtDNA was quantified by ddPCR. The reaction mixture of ddPCR had this composition in 20 µL of the final volume: 10 ng of DNA samples, 2X ddPCR Supermix for Probes (Bio-Rad Laboratories), and 1.1 µL of each isoform custom assay (Bio-Rad Laboratories). The thermal protocol conditions were: 95 °C for 10 min, followed by 40 cycles of 94 °C for 30 s, and 55 °C for 1 min, then 98 °C for 10 min. Droplet reading was performed on a QX200 ddPCR droplet reader (Bio-Rad laboratories). Analysis was performed using QuantaSoft Analysis software (version 1.7.4.0917, Bio-Rad laboratories). The following wet-validated primers were used: ND2 (Bio-Rad, Hercules, CA, USA, #10031252) and Actb (Bio-Rad, Hercules, CA, USA, #10042961).
6
Quantifying Exogenous WI5 Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
A homozygous T3 generation line was isolated from a T2 individual. Genomic DNA was extracted from 14‐d‐old seedlings of the homozygous T3 line and wi5. The DNA was diluted to 100 ng/μL and digested with FastDigest HindIII (Thermo Scientific™ FD0504). The following primers were used for ddPCR: HMGA‐F1, 5′‐GAAATCCCTGAGCGAGTCGGTA‐3′ and HMGA‐R1, 5′‐AGTAACAACGCAATTGAAGCATC‐3′ as the internal reference; and WI5_DDPCR_F1, 5′‐TGGCGCAGGAGTCCCTGGAG‐3′ and WI5_DDPCR_R1, 5′‐GAGACCTGGTAGGTGGCGTAGA‐3′ for amplification of both endogenous and exogenous WI5. Sample amplification and data analysis were performed using QX200 ddPCR EvaGreen Supermix (Bio‐Rad 186‐3022) and the QX200 Droplet Digital PCR System (Bio‐Rad 186‐4001).
7
Primary Neuron Culture and Transfection
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Basic chemical reagents include: NaCl (S3014, Sigma-Aldrich), sucrose (S0389, Sigma-Aldrich), glucose (G8270, Sigma-Aldrich), HEPES (H3375, Sigma-Aldrich), KCl (P9541, Sigma-Aldrich), MgSO4 (M2643, Sigma-Aldrich), K-gluconate (P1847, Sigma-Aldrich), EGTA (E3889, Sigma-Aldrich), MgCl2 (M9272, Sigma-Aldrich), CaCl2 (223506, Sigma-Aldrich), KOH (P250, Thermo Fisher) and NaOH (S5881, Sigma-Aldrich).
Cell culture reagents include: high-glucose Dulbecco’s Modified Eagle Medium (D1145, Sigma-Aldrich), fetal bovine serum (F2442, Sigma-Aldrich), glutamine (G7513, Sigma-Aldrich), Penicillin/Streptomycin (P4333, Sigma-Aldrich), Geneticin (G418) Sulfate (30–234-CR, Corning), 30–70 kD poly-D-lysine (P7886, Sigma-Aldrich), 300 kD poly-D-lysine hydrobromide (P7405, Sigma-Aldrich) and phosphate-buffered saline (PBS, SH302560, HyClone, GE Healthcare).
Primary neuronal culture reagents include: phenol-red-free Neurobasal medium (12348017, Gibco), B-27 (17504044, Gibco), Glutamax (35050061, Gibco) and cytosine β-D-arabinofuranoside (C1768, Sigma-Aldrich).
Transfection and cloning reagents include: jetPRIME (114–15, Polyplus Transfection), FuGENE HD transfection reagent (E2311, Promega), lipofectamine 2000 (11668019, Thermo Fisher Scientific), FastDigest NheI (FD0974, Thermo Fisher Scientific) and FastDigest HindIII (FD0504, Thermo Fisher Scientific).
Cell culture reagents include: high-glucose Dulbecco’s Modified Eagle Medium (D1145, Sigma-Aldrich), fetal bovine serum (F2442, Sigma-Aldrich), glutamine (G7513, Sigma-Aldrich), Penicillin/Streptomycin (P4333, Sigma-Aldrich), Geneticin (G418) Sulfate (30–234-CR, Corning), 30–70 kD poly-D-lysine (P7886, Sigma-Aldrich), 300 kD poly-D-lysine hydrobromide (P7405, Sigma-Aldrich) and phosphate-buffered saline (PBS, SH302560, HyClone, GE Healthcare).
Primary neuronal culture reagents include: phenol-red-free Neurobasal medium (12348017, Gibco), B-27 (17504044, Gibco), Glutamax (35050061, Gibco) and cytosine β-D-arabinofuranoside (C1768, Sigma-Aldrich).
Transfection and cloning reagents include: jetPRIME (114–15, Polyplus Transfection), FuGENE HD transfection reagent (E2311, Promega), lipofectamine 2000 (11668019, Thermo Fisher Scientific), FastDigest NheI (FD0974, Thermo Fisher Scientific) and FastDigest HindIII (FD0504, Thermo Fisher Scientific).
8
MAPKBP1 and WDR62 Plasmid Engineering
9
Cloning and Expression of catA Gene
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
E. coli M15 strain QIAexpress was purchased from Qiagen, USA. DNA was extracted from P. putida FACU (accession number LC425130.1) using genomic DNA isolation kit (GeneDirex, Inc, Taiwan, cat. no. SN023-0100). The catA open reading frame (OPF) was amplified by PCR utilizing the catA-BamHI and catA-HindIII primers (Additional file 1 : Table S1). A BamHIsite was introduced to the forward primer whereas a HindIIIsite was introduced to the reverse one. The amplified product was digested with BamHI (FastDigest BamHI, Thermo scientific™, cat. no. FD0054) and HindIII (FastDigest HindIII, Thermo scientific™, cat. no. FD0504). Then, the 936 bp DNA fragment was cloned into a pQ30 vector (N-Terminus pQE Vector Set, Qiagen, USA, cat. no. 32915) that digested with the same restriction enzymes followed by T4 DNA Ligase (Thermo Fisher Scientific, USA, cat. no. EL0011) reaction. The resulting constructs, designated pQ30-catAusing snapgene software (Additional file 1 : Fig. S1). Heat shock transformation was used to introduce the recombinant vector into the E. coli M15 strain.
10
Primary Neuron Culture and Transfection
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!