Sybr green qpcr mix

The leaf and root RNA was extracted and synthesized to cDNA by using RNA prep Pure Plant Kit (RN38, Aidlab, Beijing, China) and TRUE-script first Strand cDNA Synthesis Kit (PC5402, Aidlab, Beijing, China) following the manufacturer’s instruction. Quantitative real-time PCR was performed by SYBR Green qPCR Mix (PC3302, Aidlab, Beijing, China). The relative expression level of studied genes was analyzed by 2^−ΔΔCT method (Livak and Schmittgen, 2001 (link)). The primers used for qRT-PCR were shown in Table S1.

Total RNAs were isolated from tumor cells using TRIzol (Invitrogen, Grand Island, NY). A complementary DNA (cDNA) synthesis kit (Aidlab, Beijing, China) was then used to initiate cDNA synthesis. Quantitative reverse transcription‐polymerase chain reaction (qRT‐PCR) was carried out on an ABI 7900HT sequence detection machine (Thermo Fisher Scientific, Waltham, MA) with SYBR Green qPCR Mix (Aidlab). All experiments were done in duplicate. The 2-ΔΔCt method was utilized to compute the results. (METTL3 Forward Primer: TTGTCTCCAACCTTCCGTAGT, Reverse Primer: CCAGATCAGAGAGGTGGTGTAG; BLACAT2 Forward Primer: GCAGAATCGCTTGAACCCAGGAG, Reverse Primer: AGATGGAGTTTCGCTCTTGTTGCC; mir-193b-5p Forward Primer: CGGGCCGGGGTTTTGAGGGC, Reverse Primer: CAGCCACAAAAGAGCACAAT).

Total RNA was extracted from tea leaves, Arabidopsis leaves and respective roots using the Quick RNA Isolation Kit according to the manufacture’s protocol (Huayueyang, Beijing, China). The RNA was treated with gDNA Eraser to remove DNA contaminants (Aidlab, Beijing, China). Reverse transcription was performed using TRUEscript RT Kit (Aidlab, Beijing, China) with 1 μg RNA. The resulting cDNAs were diluted at 1:10 with ddH₂O, and qRT-PCR was performed using an ABI StepOnePlus Real-Time PCR System (Applied Biosystems) with SYBR Green qPCR Mix (Aidlab, Beijing, China) following a recommended protocol. Fold changes in gene expression were calculated by comparing the C_T values using the 2^−ΔΔ method [58 (link)] with the internal control genes of CsGAPDH for Camellia sinensis and AtGAPDH for Arabidopsis. Three biological replicates were performed, and each replicate was collected from at least two independently grown sets of plants. Accession numbers and primer sequences are shown in Supplementary Table S5.

The Caco-2 cells were seeded in six-well plates (Corning Costar Co., NY, USA) at a density of 4 × 10⁴ cells/cm², and were cultured for 21 days. After incubation with each tea catechins (300 μmol/L in full culture medium) for 2 h or 24 h, the total RNA from the Caco-2 cells were isolated with a Total RNA Kit (Aidlab, Beijing, China). First-strand cDNA was synthesized using a cDNA synthesis Kit (Aidlab, Beijing, China). The gene expression of MRP2 was examined by quantitative real-time PCR with the SYBR Green qPCR Mix (Aidlab, Beijing, China) in an ABI7500 Real-Time System (Applied Biosystems, USA). The reaction was carried out in a 10 μL RT-reaction mixture containing 5 μL 2 × SYBR Green qPCR Mix, 0.2 μL forward and reverse primers (10 μmol/μL), and water to a final volume of 10 μL, and was performed under the following cycling conditions: an initial denaturing step of 10 min at 95 °C, followed by 40 cycles consisting of 5 s at 95 °C and 34 s at 60 °C.
All of the qPCR experiments were repeated in three biologicals. The data were analyzed using the 2-ΔΔCT method [39 (link)]. All of the primers were synthesized by Sangon Biotech (Shanghai, China), as previously described [40 (link)], and their sequences are depicted in Table 3.

Quantitative PCR (qPCR) was performed using a volume of 10 μL containing 1× Sybr green qPCR mix (Aidlab), 0.5 μL each forward and reverse primers (10 μM), and 1 μL template cDNA. To determine the relative expression levels of the target genes, the β-tubulin gene BctubA was chosen as the internal reference gene, which was partially amplified by using primer pair qTubA-F/qTubA-R (see Table S5 in the supplemental material). Primer pair q820-1640F20/q820-1771R19 was used to amplify the partial sequence of the Bcmdl1 gene. A QuantStudio 7 Flex real-time PCR system (Applied Biosystems, CA, USA) was used to perform qPCR under the following conditions: an initial preheating step at 94°C for 3 min followed by 40 cycles of denaturation at 95°C for 20 s, annealing at 56°C for 20 s, and extension at 72°C for 20 s. The fluorescence signal was detected at the extension stage of each cycle. A melt curve was obtained by incubating the products at 94°C for 20 s, 65°C for 1 min, and 95°C for 15 s. When increasing the temperature from 65°C to 95°C at a rate of 0.05°C/s, the fluorescence signal was detected simultaneously. The expression level of the Bcmdl1 gene was normalized to the expression level of the BctubA gene, and relative gene expression was calculated by the comparative threshold cycle (C_T) (2^−ΔΔCT) method (53 (link)). The experiment was performed in triplicate and repeated twice.

A modified SYBR Green-based real time fluorescent quantitative polymerase chain reaction (qPCR) method was utilized to detect the impact of LSS-11 on the melting temperature (Tm) of DNA. A 63 bp DNA fragment was amplified by PCR using SYBR Green qPCR Mix (AidLab Biotech, Beijing, China) and cDNA template with specific primers (Table 2), then the resulted DNA product was equally aliquoted and incubated with indicated concentrations of LSS-11 for 30 min at room temperature. After that the melting curves and Tm values were determined by a Bio-Rad CFX Connect Real-Time PCR Detection system (Bio-Rad Laboratories, Berkeley, CA) at 1°C/cycle increment.