RIP assay was used to determine whether AGAP2-AS1 interacts with or binds to RNA-binding proteins (EZH2, SUZ12, and LSD1) in the human GC cells. The EZ-Magna RIP kit (Millipore, Billerica, MA, USA) was used to conduct the RIP experiment, following manufacturer’s protocol. The BGC-823 and AGS cells were lysed using complete RIP lysis buffer; then, the extract was incubated with magnetic beads conjugated with EZH2, SUZ12, and LSD1antibodies or control IgG (Millipore) for 6–8 h at 4 °C. Next, the beads were washed with washing buffer and incubated with proteinase K at 55 °C for 30 min to remove the proteins. Finally, purified RNA was reverse-transcribed into cDNA and subjected to qRT-PCR analysis to determine the presence of AGAP2-AS1 using specific primers. EZH2 (Cat.No.17-662), SUZ12 (Cat.No.03-179), LSD1 (Cat.No.17-10531), CoREST (Cat.No.07-455), and HuR (Cat.No.03-102) antibodies were purchased from EMD Millipore.
Corest
Manufactured by Merck Group
CoREST is a laboratory equipment product designed to facilitate specific research applications. It serves as a tool to assist researchers in their investigations, providing core functionality to support their research objectives. The details of its intended use and specific applications are not included in this factual, unbiased description.
Automatically generated - may contain errors
Lab products found in correlation
Dynabead, by Thermo Fisher Scientific (3 mentions)
Enhanced chemiluminescence kit, by PerkinElmer (3 mentions)
Protran, by Cytiva (3 mentions)
β actin, by Merck Group (3 mentions)
Sin3a, by Santa Cruz Biotechnology (2 mentions)
Phospho ser pkc substrate, by Cell Signaling Technology (2 mentions)
Sc 994, by Santa Cruz Biotechnology (2 mentions)
Sc 9446, by Santa Cruz Biotechnology (2 mentions)
Sin3a sc 994x, by Santa Cruz Biotechnology (2 mentions)
Mta1 sc 9446, by Santa Cruz Biotechnology (2 mentions)
Ez magna rip kit, by Merck Group (1 mentions)
Control igg, by Merck Group (1 mentions)
Sample lysis buffer, by Bio-Rad (1 mentions)
Actin, by Cell Signaling Technology (1 mentions)
Gapdh, by Bioworld Technology (1 mentions)
Hdac1, by Abcam (1 mentions)
H3k4me1, by Merck Group (1 mentions)
H3k4me2, by Merck Group (1 mentions)
Hdac2, by Abcam (1 mentions)
Rbbp4, by Abcam (1 mentions)
13 protocols using corest
1
RNA-binding Protein Interaction Profiling of AGAP2-AS1
2
HDAC1 Immunoprecipitation and Western Blot
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Nuclear lysates (150 µg) were immunoprecipitated with 3 µg of isotype-matched control or anti-HDAC1 monoclonal antibody (mAb) (Cell Signaling Technology) for 3 h at 4 °C, washed 4 times with washing buffer containing 20 mM Tris-Cl (pH: 7.5), 150 mM NaCl, 0.1% NP-40, 1 mM DTT, 1 mM EDTA, 1 mM PMSF and protease inhibitor mixture, and lysed by boiling with sample lysis buffer (BioRad Laboratories) containing β-mercaptoethanol. Western blotting was performed using anti-HDAC1 and anti-HDAC2 mAbs (Cell Signaling Technology), as well as polyclonal Abs directed against phosphorylated HDAC2 (Serine 394, Abcam), LSD1 (EMD Millipore), CoREST (EMD Millipore), and actin (Cell Signaling Technology).
3
Western Blot Analysis of Epithelial-Mesenchymal Transition Markers
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Cells were collected and lysed as previously described.29 The proteins were separated and electrotransferred to PVDF membrane. After blocking, primary Abs (E‐cadherin, 14472S; Claudin3, ab214487; α‐catenin, ab51032; Vimentin, ab92547; Slug, 9585S; LSD1, ab17721; GATA3, ab199428; ERα, 13258S; GAPDH, Bioworld AP0063; CoREST, Merck 07‐455; histone deacetylase 1 [HDAC1], ab7028; and HDAC2, ab12169) were detected using anti‐rabbit or anti‐mouse Abs, and visualized on a Tanon‐5200 Chemiluminescent Imaging System.
4
Immunoprecipitation of Chromatin Regulators
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total protein extracts from brain were harvested as described above. Equal amounts of 1 mg of protein were incubated for 1 h at 4°C with 4 μg antibody. Immunoprecipitation was carried out by using protein A beads or protein G beads (Dynabeads; Invitrogen) overnight at 4°C. The immune complexes were washed three times with Hunt buffer. Samples were used for an HDAC activity assay, or they were heated in SDS sample buffer and used for immunoblotting. Primary antibodies used for coimmunoprecipitation were Sin3A (catalog number sc-994X; Santa Cruz), CoREST (catalog number 07-455; Millipore), and MTA1 (catalog number sc-9446; Santa Cruz) antibodies.
5
Histone Peptide Pull-Down Assay
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
One hundred micrograms of lyophilized histone peptides (H3K4ac, Epicypher; unmodified H3, H3K4me1, H3K4me2, H3K4me3; Millipore) were dissolved in 400 µL of PBS. 1 × 108 MEFs were hypotonically lysed with Buffer A (10 mM HEPES at pH 7.9, 1.5 mM MgCl2, 10 mM KCl, freshly added protease inhibitors and DTT to 1 mM) before nuclear extract was isolated with Buffer C (20 mM HEPES at pH 7.9, 25% v/v glycerol, 420 mM KCl, 1.5 mM MgCl2, 0.2 mM EDTA, freshly added protease inhibitors and DTT to 1 mM) and the salt concentration lowered to 150 mM using Buffer D (20 mM HEPES at pH 7.9, 20% v/v glycerol, 0.2 mM EDTA, 0.2% Triton X-100). Following mechanical lysis by sonication, 50 µL of prewashed avidin-histone peptide slurry was added to precleared lysate and incubated overnight at 4°C. After washing of the avidin beads, SDS sample buffer was added and samples were boiled for 5 min and subsequently run on a 10% SDS gel. The following antibodies were used for the histone peptide pull-down assay: mSin3A (Abcam, ab3479), CoREST (Millipore, 07–455), HDAC2 (Abcam, ab7029), HDAC1 (Abcam, ab7028), RBBP4 (Abcam, ab79416), MTA1 (Santa Cruz, sc-9446).
6
Hypoxia-Induced ChIP Assay Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
ChIP assays where performed as previously described60 (link). Briefly, HEK293 cells fully confluent on T175 flasks were conditioned to hypoxic media (1% oxygen) for the indicated time points. Cells were fixed with 2% formaldehyde in 10 mL fresh media for 10 min with agitation. Cells were removed from the hypoxic chamber and fixation was stopped with 125 mM glycine treatment for 5 min. The following mix was prepared: 1 uL of the purified DNA was used, 0.4 μL of 20 μM primers, 8 uL RNAse free water and 10 μL of Power SYBR® Green (Applied Biosystems). The quantitative Real-Time PCR was performed using the 7900HT Fast Real-Time PCR System. Precipitated chromatin was normalized to input samples and the control IgG IP’s are shown as a negative control, as previously described60 (link).
The following ChIP qRT-PCR primers were used:
HIF-RE1, F: AGAGGCTCGGAGCCGG, R: CGCTTCTCTCTAGTCTCACGAG
The following antibodies were used:
Rabbit CoREST, 5 μg, Millipore, 07–455; Rabbit REST, 2 μg, Millipore, 17–641; Rabbit mSin3A, 5 μg, SCB, sc-994; Rabbit IgG, 5 μg, Millipore, PP64B.
The following ChIP qRT-PCR primers were used:
HIF-RE1, F: AGAGGCTCGGAGCCGG, R: CGCTTCTCTCTAGTCTCACGAG
The following antibodies were used:
Rabbit CoREST, 5 μg, Millipore, 07–455; Rabbit REST, 2 μg, Millipore, 17–641; Rabbit mSin3A, 5 μg, SCB, sc-994; Rabbit IgG, 5 μg, Millipore, PP64B.
7
Protein Extraction and Immunoblotting from Frozen Brains
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Dissected brains were immediately frozen in liquid nitrogen and stored at −80°C. For protein extraction, frozen brains were manually homogenized in Hunt buffer (20 mM Tris-HCl [pH 8.0], 100 mM sodium chloride, 1 mM EDTA, 0.5% NP-40) supplemented with protease inhibitor cocktail (Roche) and phenylmethylsulfonyl fluoride (PMSF) in a glass homogenizer. After full-speed centrifugation, the supernatant containing the soluble protein fraction was further used. Equal amounts of 20 to 30 μg of proteins were separated by SDS-PAGE (10% gels) and transferred onto nitrocellulose membranes (Protran; Whatman) according to standard protocols. For detection, the Enhanced Chemiluminescence kit (PerkinElmer) was used. HDAC activity assays were performed with brain protein extracts as previously described (9 (link)). Primary antibodies for immunoblotting were HDAC1 (10E2 or Sat13), HDAC2 (3F3), Sin3A (catalog number sc-994; Santa Cruz), CoREST (catalog number 07-455; Millipore), MTA1 (catalog number sc-9446; Santa Cruz), PKCδ (catalog number 610397; BD), and β-actin (catalog number A5316; Sigma) antibodies.
8
Brain Protein Extraction and Western Blot Analysis
9
Co-immunoprecipitation of HDAC Complex
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total protein extracts from brain were harvested as described above. Equal amounts of 1 mg of protein were incubated for 1 hour at 4°C with 4 μg antibody. The immunoprecipitation was carried out using protein A-beads or protein G-beads (Dynabeads©, Invitrogen) overnight at 4°C. The immune complexes were washed three times with HUNT buffer. Samples were used for an HDAC activity assay or they were heated in SDS sample buffer and used for immunoblotting. Primary antibodies used for co-immunoprecipitation: SIN3A (sc-994X, Santa Cruz), CoREST (07-455, Millipore), MTA1 (sc-9446 Santa Cruz).
10
Brain Protein Extraction and Western Blot Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Dissected brains were immediately frozen in liquid nitrogen and stored at −80°C. For protein extraction, frozen brains were manually homogenized in HUNT buffer (20 mM Tris-HCl pH 8.0, 100 mM sodium chloride, 1 mM EDTA, 0.5% NP-40) supplemented with protease inhibitor cocktail (Roche) and phenylmethanesulfonyl fluoride (PMSF) in a glass homogenizer. After full speed centrifugation, the supernatant containing the soluble protein fraction was further used. Equal amounts of 20-30 μg of proteins were separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) (10% gels) and transferred onto nitrocellulose membranes (Protran, Whatman) according to standard protocols. For detection the Enhanced Chemiluminescence Kit (PerkinElmer) was used. HDAC activity assays were performed with brain protein extracts as previously described (Lagger et al., 2002 (link)). Primary antibodies for immunoblotting: HDAC1 (10E2 or Sat13), HDAC2 (3F3), SIN3A (sc-994, Santa Cruz), CoREST (07-455, Millipore), MTA1 (sc-9446, Santa Cruz), PKCδ (610397, BD), TuJ1 (ab14545, Abcam), phospho-(Ser) PKC Substrate (2261, Cell Signaling), LC3 (0260-100, NanoTools), β-actin (A5316, Sigma).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!