Plvx acgfp1 n1 vector

Human colon carcinoma HT29 and DLD1 cell lines were obtained from the American Type Culture Collection and cultured in RPMI-1640 medium containing 10% FBS. For stable cell line selection, human GRP78 cDNA was subcloned into the pLVX-AcGFP1-N1 Vector (Clontech). GRP78 shRNAs constructed in pLKO.1-Puro were purchased from Sigma (Mission shRNA). GRP78 overexpression/shRNA plasmid, psPAX2 and pMD2.G were co-transfected into 293T cells at 15:10:5 g. Media containing virus was collected and concentrated using 100 kDa ultrafiltration membranes (Millipore). DLD1 cells were infected with the viruses in the presence of polybrene (8 μg/ml) for 24 h, and then subjected to selection by 5 μg/ml puromycin. Hairpin sequences in these shRNA constructs are depicted as follows: Table 1 shRNA sequences used in this study: GRP78-1: 5’-CCGGAGATTCAGCAACTGGTTAAAGCT CGAGCTTTAACCAGTTGCTGAATCTTTTTTG-3’; GRP78-2: 5’-CCGGGAGCGCATTGATACTAGAAATCTCGAGATTTCTAGTA TCAATGCGCTCTTTTTG-3’; Control: 5’-CCGGCCTAAGGTTA AGTCGCCCTCGCTCGAGCGAGGGCGACTTAACCTTAGGTT TTTG-3’.

NSC‐34 (Cedarlane), HEK 293T (ATCC) and SH‐SY5Y (ATCC) cells were used in this study. SH‐SY5Y cells were differentiated with retinoic acid prior to incubation with sEV. HEK 239A with GFP knocked‐into the AAVS1 locus using CRISPR was obtained from Ryan Russell (University of Ottawa). emGFP was knocked‐in with CRISPR technology. HEK 293T expressing GFP siRNA in a pre‐miR‐451 backbone was previously described (Reshke et al., 2020 (link)). Neonatal normal human dermal fibroblast (NHDF‐Neo) (Cedarlane, CC‐2509) were transduced with lentivirus (pLVX‐AcGFP1‐N1 vector, Clontech, 632154)