Sequencing of randomly sheared total genomic DNA of the cytotype B6B6 of P. autumnale was performed by the Center for Medical Research, Graz, Austria using a Roche/454 GS FLX instrument with Titanium reagents (Roche Diagnostics). Sequencing half a 70 × 75 picotitre plate yielded 555 480 reads of average length 350 bp. Quality-filtered reads (397 694 corresponding to 2·2% coverage of the genome) were subjected to graph-based clustering analysis, as described by Novák et al. (2010) (link), to identify groups of reads representing repetitive elements (H. Weiss-Schneeweiss et al., unpubl. res.). One hundred and ninety-five out of a total of 19 751 clusters, corresponding to the most abundant families of genomic repeats, were analysed for their similarity to known sequences using RepeatMasker Open-3.0 (http://www.repeatmasker.org ) and BLAST (Altschul et al., 1990 (link)) searches against GenBank databases and a database of plant mobile element protein sequences (Novák et al., 2013 (link)). Graphical layouts of individual clusters were examined using the SeqGrapheR program (Novák et al., 2010 (link)).
Titanium reagents
Manufactured by Roche
Sourced in United States, China
Titanium reagents are a line of laboratory products used in various analytical and research applications. They are designed to provide consistent and reliable performance for researchers and technicians. The core function of these reagents is to facilitate specific chemical reactions and analyses, supporting the needs of modern laboratory workflows.
Automatically generated - may contain errors
Lab products found in correlation
454 gs flx instrument, by Roche (3 mentions)
454 gs flx sequencer, by Roche (1 mentions)
Biophotometer, by Eppendorf (1 mentions)
Rneasy plant midi kit, by Qiagen (1 mentions)
Quant it dsdna hs assay kit, by Thermo Fisher Scientific (1 mentions)
Powermax soil dna isolation kit, by Qiagen (1 mentions)
Powerwater dna isolation kit, by Qiagen (1 mentions)
Genome sequencer flx, by Roche (1 mentions)
7 protocols using titanium reagents
1
Sequencing and Characterization of Genomic Repeats in P. autumnale
2
RNA Extraction and Normalization for Transcriptome Sequencing
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from entire shoots, including leaves and traps, from all three sources described above. Inflorescences were not used in this study. Approximately 800 mg of fresh weight (2 individuals) of whole shoots in three replicates from each source were ground in liquid nitrogen using a mortar and pestle and RNA was extracted using RNeasy Plant Midi Kit (Qiagen Inc., Valencia, CA, USA). The results of the parallel extractions were pooled in equal proportions into a single sample and the quality and quantity of the extracted RNA were verified by gel electrophoresis and by spectrophotometer, measuring the 230/260 ratio with Biophotometer (Eppendorf, Germany).
A pooled RNA sample was provided to GATC Biotech (Konstanz, Germany) for the construction of a cDNA library and subsequent sequencing. Library construction involved DNAselection for polyadenylated (polyA+) transcripts to enrich for protein-coding mRNAs, DNase I treatment and normalization through denaturation/reassociation of cDNA, to improve the representation of low-copy transcripts and thereby maximize gene discovery. The resulting library was sequenced with a full picotiter plate on a 454 GS-FLX sequencer with Titanium reagents (Roche Applied Science, Indianapolis, IN, USA), using standard 454 protocols.
A pooled RNA sample was provided to GATC Biotech (Konstanz, Germany) for the construction of a cDNA library and subsequent sequencing. Library construction involved DNAselection for polyadenylated (polyA+) transcripts to enrich for protein-coding mRNAs, DNase I treatment and normalization through denaturation/reassociation of cDNA, to improve the representation of low-copy transcripts and thereby maximize gene discovery. The resulting library was sequenced with a full picotiter plate on a 454 GS-FLX sequencer with Titanium reagents (Roche Applied Science, Indianapolis, IN, USA), using standard 454 protocols.
3
Profiling Aquifer Microbial Communities
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Following sample collection, water samples for bar-coded pyrosequencing were filtered through 5 μm membranes to remove sediment particles. Microbial biomass was then collected on a 0.22 μm membrane filter. Microbial community DNA from the water samples were extracted using the PowerWater DNA Isolation Kit (MoBio laboratories, Inc., Carlsbad, CA, USA), while the microbial community DNA from the sediment samples were extracted using the PowerMax Soil DNA Isolation Kit (MoBio laboratories, Inc., Carlsbad, CA, USA). DNA concentration and quality were determined using a Qubit fluorometer (Quant-iT dsDNA HS Assay Kit; Invitrogen) and by 1.5% TBE agarose gel electrophoresis (Bioline). High molecular weight DNA was then sent to the Molecular Research LP (MR DNA; Texas, USA) for 16S rRNA gene based bar-coded pyrosequencing [32 (link)]. Bacterial diversity of aquifer clogging was analysed by amplification of the 16S rRNA gene using the primers 27F (5’-AGRGTTTGATCMTGGCTCAG -3’) and 519R (5’-GTNTTACNGCGGCKGCTG -3’). Sequencing was conducted on the GS-FLX pyrosequencing platform using Titanium reagents (Roche).
4
Next-Generation Sequencing for EGFR Mutation Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
PCR products were processed before NGS as described in Supporting Information (Method S1 in File S1 ). A mean of 500.000 enriched beads was used for massively parallel pyrosequencing in a Titanium PicoTiterPlate (PTP) with Titanium reagents (Roche Diagnostics), on the GS Junior instrument, according to the 454 GS Junior Titanium Series Amplicon Library Preparation Method Manual (available online: www.454.com ). Processed and quality-filtered reads were analysed with the GS Amplicon Variant Analyzer (AVA) software version 2.7 (454 Life Sciences). EGFR exons 19 and 21 reference sequences were extracted from Hg19 Human Genome Version together with both neighbor intronic regions. Such sequences were used as Reference Sequences to align every reads and the final alignments were checked manually. NGS analysis was repeated in cases with mutations in less than 1% of the DNA molecules to differentiate real mutations from low-level errors introduced during PCR amplification and sequencing. All identified mutations were searched in the online COSMIC database (http://cancer.sanger.ac.uk/cancergenome/projects/cosmic ).
5
454 GS FLX Titanium Mate Pair Sequencing
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
3-kb and 8-kb mate pair libraries were constructed according to the 454 GS FLX Titanium paired-end protocol with Titanium reagents (Roche) and sequenced on a full PicoTiterPlate on a Genome Sequencer FLX+ Instrument. Sequencing data were processed and bases called using the Roche 454 Software Version 2.6 (shotgun sequencing data processing pipeline).
6
Amplifying Microbial Diversity via 16S and ITS
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For analysis of bacteria diversity, partial 16S rRNA genes were amplified using primers 27F (AGAGTTTGATCMTGGCTCAG) and 533R (TTACCGCGGCTGCTGGCAC). Primer pair ITS1 (TCCGTAGGTGAACCTGCGG) and ITS4 (TCCTCCGCTTATTGATATGC) were was used to amplify partial ITS sequences of eukaryotes. Amplifications were performed using the following program: initial denaturation at 95 °C for 2 min, 25 (for 16S rRNA) or 33 (for ITS) cycles of denaturation at 94 °C for 30 s, annealing at 55 °C for 30 s, extension at 72 °C for 30 s, and a final extension at 72 °C for 5 min. Emulsion PCR was performed with the emPCRAmp-Lib L Kit (Roche) and PCR amplicons were pyrosequenced by Shanghai Majorbio Bio-pharm Technology Co. Ltd. (Shanghai, China) using a Roche 454 GS FLX instrument and Titanium reagents. Pyrosequencing generated 84,579 and 157,116 raw ITS and 16S rDNA reads, respectively.
7
Genomic Repeat Characterization in P. autumnale
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Sequencing of randomly sheared total genomic DNA of the cytotype B6B6 of P. autumnale was performed by the Center for Medical Research, Graz, Austria using a Roche/454 GS FLX instrument with Titanium reagents (Roche Diagnostics). Sequencing half a 70 × 75 picotitre plate yielded 555 480 reads of average length 350 bp. Quality-filtered reads (397 694 corresponding to 2·2 % coverage of the genome) were subjected to graph-based clustering analysis, as described by Novák et al. (2010) (link), to identify groups of reads representing repetitive elements (H. Weiss-Schneeweiss et al., unpubl. res.). One hundred and ninety-five out of a total of 19 751 clusters, corresponding to the most abundant families of genomic repeats, were analysed for their similarity to known sequences using RepeatMasker Open-3·0 (http://www.repeatmasker.org ) and BLAST (Altschul et al., 1990 (link)) searches against GenBank databases and a database of plant mobile element protein sequences (Novák et al., 2013 (link)). Graphical layouts of individual clusters were examined using the SeqGrapheR program (Novák et al., 2010 (link)).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!