The largest database of trusted experimental protocols

Hifair 2 first strand cdna synthesis kit gdna digester plus

Manufactured by Yeasen
Sourced in China

The Hifair II First-Strand cDNA Synthesis Kit (gDNA Digester Plus) is a laboratory equipment product designed for the synthesis of first-strand cDNA from total RNA samples. The kit includes a gDNA Digester Plus component, which is used to eliminate genomic DNA contamination prior to cDNA synthesis.

Automatically generated - may contain errors

4 protocols using hifair 2 first strand cdna synthesis kit gdna digester plus

1

RNA Extraction and qRT-PCR Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols
RNA extraction and quantitative real-time PCR were performed as previously described.63 (link) Total RNA was extracted from tissues or cells with TRIzol reagent (TIANGEN), and cDNA was synthesized with a Hifair II First-Strand cDNA Synthesis Kit (gDNA Digester Plus, YEASEN, China). qPCR was performed with a Hifair III One-Step RT-qPCR SYBR Green Kit (YEASEN), and triplicate samples were run on an ABI QuantStudio 5 real-time PCR system (Thermo Fisher, USA). The threshold cycle (Ct) values for each gene were normalized to those of GAPDH as an endogenous calibrator, and the 2−ΔΔCt method was used for quantitative analysis. The primers used were synthesized by Sangon Biotech and are listed in Table S2. To confirm the expression of miR-6077, we isolated RNA with a miRcute miRNA Isolation Kit (Qiagen, Germantown, MD, USA), and the reverse transcription and qPCR were performed with a miRcute Plus miRNA First-Strand cDNA Kit and miRcute Plus miRNA qPCR Kit (SYBR Green, Qiagen), respectively. Small nuclear RNA (U6) was used as an endogenous calibrator.
+ Open protocol
+ Expand
2

RNA Extraction and qRT-PCR Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols
RNA extraction and quantitative real-time PCR (qRT-PCR) were performed as previously described29 (link). Briefly, Total RNA was extracted from tissues or cells with TRIzol reagent (TIANGEN), and cDNA was synthesized with a Hifair II First-Strand cDNA Synthesis Kit (gDNA Digester Plus, YEASEN, China). qRT-PCR was performed with a Hifair III One-Step run on an ABI QuantStudio 5 real-time PCR system (Thermo Fisher, USA). The threshold cycle (Ct) values for each gene were normalized to those of Actin as an endogenous calibrator, and the 2^(−△△CT) method was used for quantitative analysis. The primers of each gene were synthesized by Sangon Biotech and are listed in Supplementary Table S1.
+ Open protocol
+ Expand
3

Quantifying HLA-DRA Expression in Tissues

Check if the same lab product or an alternative is used in the 5 most similar protocols
RNA was isolated from the peripheral blood mononuclear cell (PBMC), spleen, kidney, gut, and lung using TRleasy Total RNA Extraction Reagent (Yeasen, Shanghai). Reverse transcription RNA and cDNA synthesis was performed using a Hifair II First Strand cDNA synthesis kit (gDNA digester plus) (Yeasen), RT‐PCR was amplified with TransTaq DNA Polymerase High Fidelity (Yeasen), and all the steps were followed according to the manufacturer's protocol. Primer sequences used and the predicted amplification sizes are as follows: HLA‐DRA, 5′‐TCCGCAAGTTCCACTATCTCC‐3′ (forward) and 5′‐CCATCACCTCCATGTGCCTTA‐3′ (reverse) 275 bp.
+ Open protocol
+ Expand
4

Mutational Analysis of TCOF1 Splicing

Check if the same lab product or an alternative is used in the 5 most similar protocols
RT-PCR and Sanger sequencing were used to determine whether the mutation affected splicing. Total RNA was extracted from samples stored at − 80ºC using a PAXgene Blood RNA Kit (Qiagen; catalog no. #762,174) according to the manufacturer’s recommendations. The Qubit 3.0 Fluorometer (Life Technologies) and Nanodrop One spectrophotometer (Thermo Fisher Scientific) were used to determine RNA concentration and quality, respectively. The Agilent 2100 Biological Analyzer (Agilent Technologies Inc., CA, USA) was used to evaluate RNA integrity. Briefly, 1 µg of RNA was reverse-transcribed using a Hifair II First Strand cDNA Synthesis Kit (gDNA Digester Plus; Yeasen Biotech, Shanghai, China; catalog no. 11121ES50). Primers binding to exons 23–26 of TCOF1 were used for RT-PCR of the cDNA-amplified region:

F: 5’- GCAGGCATGTTGTCCCCTAA-3’;

R: 5’- GTGCTGGTGCTCGTCATACA-3’;

The molecular weights of RT-PCR products were determined via agarose gel electrophoresis followed by Sanger sequencing after band elution from the gel and purification.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!