7300 system sds software

Total RNA was automatically isolated by Maxwell® 16 system (Promega; Mannheim, Germany), and cDNA was obtained by the High Capacity cDNA Reverse Transcription Kit (Applied Biosystems; Foster City, CA, USA). Real-time polymerase chain reaction (qPCR) was carried out on a 7300 Real-Time PCR System, using the TaqMan® chemistry with commercial primers and probes (BAX, Hs01016552_g1; BCL2, H Hs00608023_m1) (Applied Biosystems; Foster City, CA, USA). Gene expression was normalized to the reference gene β-actin (4326315e). Data were analyzed with 7300 System SDS Software (Applied Biosystems; Foster City, CA, USA), and are presented as mean fold change of expression compared to control cells, normalized to one.

Isolation of total RNA and reverse transcription reaction were performed using RNeasy® plus universal mini kit (Qiagen, 81 Bay Street, Suite 4400. Toronto, Ontario M5J 2T3, Canada), high‐capacity cDNA reverse transcription kit (Applied Biosystems, Thermo Fisher Scientific, 3410 Griffith St, Saint‐Laurent, Quebec H4T 1Y6, Canada). qPCR was conducted using SensiFAST™ SYBR^® Lo‐ROX kit (Bioline, 3971 Old Walnut Rd, Alvinston, Ontario N0N 1A0, Canada) on the AB7300 machine and analyzed using the 7300 system sds Software (Applied Biosystems); reaction was controlled for the absence of genomic DNA amplification. Each experiment was carried out in independent triplicate. Primers were designed using Primer‐BLAST program (http://www.ncbi.nlm.nih.gov/tools/primer‐blast/) for human genes encoding β‐actin (NM_001101.5, forward: 5′‐CGGCTACAGCTTCACCACCACG and reverse: 5′‐AGGCTGGAAGAGTGCCTCAGGG) and IGF1R (NM_000875.5, forward: 5′‐CGGGGAGAGAGCCTCCTGTGA and reverse: 5′‐GCTGTTGGAGCCGCAGGCAT) and ZEB1 (NM_001128128.2, forward: 5′‐GAAGACAAACTGCATATTGTGGAAG and reverse: 5′‐CATCCTGCTTCATCTGCCTGA).

As reported in Table 2, we selected six functional and common SNPs of the TGF-β pathway and one of the VEGF-A gene. Selection of these SNPs was performed using information acquired from dbSNP NCBI, the ENSEMBL database (http://www.ensembl.org/index.html, accessed on 3 April 2022), and the UCSC Genome Browser website (http://genome.ucsc.edu, accessed on 3 April 2022). Alleles and genotypes were analyzed using on demand assays developed by KBioscience Ltd. (Middlesex, UK). Tests apply homogeneous Fluorescence Resonance Energy Transfer (FRET) detection and allele specific PCR (Kaspar) as previously described [30 (link)]. The genotypes were determined using the 7300 system SDS software, vs. 1.3 (Applied Biosystems, Monza (Mi) Italy) sample by sample, on the basis of the detection of unique (homozygous samples) or double (heterozygous samples) fluorescence signals.

Genomic DNA was extracted from whole blood containing EDTA by standard techniques. The IL-10 −1082 A/G (rs1800896), IL-10 −819 C/T (rs1800871), IL-10 −592 A/C (rs1800872), TNF-α −238 A/G (rs361525), TNF-α −308 A/G (rs1800629), IFN-γ −179 G/T (rs2069709), IFN-γ −155 G/A (rs2069710), TGF-β −509 T/C (rs1800469) and TGF-β 29 T/C (rs1800470) SNPs were genotyped using 5′ exonuclease TaqMan genotyping assays on a 7900HT Fast real-time PCR system, according to the manufacturer’s instructions (Applied Biosystems, Foster City, CA, USA). Each SNP (allele and genotype) was manually and automatically defined with allelic discrimination software (7300 System SDS Software^® by Applied Biosystems, Foster City, CA, USA) (Table 1).

Expression of several mRNA was analyzed by real-time quantitative PCR (qRT-PCR) using the 7300 System SDS Software (Applied Biosystems). Total RNA was isolated from 10⁶ cells with RNeasy extraction kit (Qiagen) according to the manufacturer's instructions. RNAs were reverse-transcripted with a Thermoscript RT-PCR system kit (Invitrogen). Primers were obtained from Eurogentec. Q-PCR reactions were performed with the Power SYBR Green PCR master mix in a MicroAmp optical 96-well reaction plate according to the manufacturer's instructions (Applied Biosystems). Gene expression levels were normalized by β2-microglobulin expression and expressed as 2-ΔCT (Arbitrary Units) as previously described [7] (link).

Genetic analyses were performed at the Human Genetics Lab of the University of
Madeira. Genomic DNA was extracted from 80 µl of peripheral blood using a
standard phenol-chloroform method. A TaqMan allelic discrimination assay for
genotyping was performed using labelled probes and primers pre-established by
the supplier (TaqMan SNP Genotyping Assays, Applied Biosystems).
All reactions were done on an Applied Biosystems 7300 Real Time PCR System and
genotypes were determined using the 7300 System SDS Software (Applied
Biosystems, Foster City, USA) without any prior knowledge of individual’s
clinical data. Quality of genotyping techniques was controlled by the inclusion
of one non-template control (NTC) in each plate of 96 wells. All SNPs TaqMan
assays had blind duplicates accounting for 20% of all samples. Some SNP
genotypes were randomly confirmed by conventional direct DNA sequencing, as
10-15% of all samples were re-amplified for sequencing. Call rates for SNPs in
the GRS were 98%-100% and a minimum 95% call rate was set for quality
control.