Plenti pgk hygro dest

The lentiviral plasmid vector expressing TERT and puromycin acetyltransferase (pac) (pSD-83) was described by Duss et al [12 (link)]. The vector expressing BMI1 and CFP (pER7)
was constructed from pSD-84 [12 (link)] by
replacing the pac gene with CFP by standard cloning. The vector expressing
MYC and hygromycin phosphohydrolase
(hph) (pSV32) was constructed by shuffling
the MYC open reading frame from pSD-94
[12 (link)] into pLenti PGK-hygro DEST
(Addgene 19066) by Gateway cloning. The vector expressing CCND1 and neomycin phosphotransferase (npt) (pSV31) was constructed by Gateway cloning of the CCND1 open reading frame from pENTR-CCND1 (PlasmID
HsCD00001252) into pLenti PGK-Neo DEST (Addgene 19067). The pLVTH-sip53 vector
expressing GFP and a short hairpin RNA
targeting TP53 was obtained from Addgene
(12239). The vector expressing PIK3CA-H1047Rand hph (pER157) was constructed by cloning the
PIK3CA-H1047R open reading frame from
pBABE-PIK3CA (PlasmID clone 25920) into pENTR1A to give pER152, then transferred
by Gateway cloning into pLenti CMV/TO-hygro DEST (Addgene 17484). The vector
expressing tdTomato (pER5) was kindly provided by Francois Moreau-Gaudry.

Bmal1, Tip60 ORFs were amplified by PCR and cloned into pcDNA3.1 vector containing either C-terminal myc- or V5-tags. Single site mutations were introduced by using the QuikChange II Site-directed Mutagenesis Kit (Agilent Technologies). Tip60^V5 and Tip60^{C369A;E403Q;V5} were cloned into pLenti PGK Hygro DEST vector. Bmal1-FLAG was from M.J. Rossner (LMU Munich). Myc-Clock and myc-Clock^mutA were from P. Sassone-Corsi. Lentiviral Bmal1-dLuc reporters were from S.A. Kay (USC Los Angeles). pBABE-puro SV40 LT (#13970), pCL-Eco (#12371), pMD2.G (#12259), psPAX2 (# 12260), pLenti PGK Hygro DEST (#19066), and pSpCas9(BB)−2A-Puro (# 48139) plasmids were from Addgene.

In our hands, overexpression of WT DNA2 using the p3xFLAG‐CMV DNA2wt (Lin et al, 2013) and pBabe hygro 3xFLAG DNA2wt vector (Duxin et al, 2012) kills host cells. Therefore, to complement the DNA2 knockout, we cloned the DNA2 cDNA into the pLenti PGK Hygro DEST (Addgene cat# 19066) vector, in which DNA2 expression is under control of the weaker PGK promoter. Specifically, WT DNA2, as well as the D294A ND and K671E HD DNA2 mutants, was PCR amplified from our original p3xFLAG‐CMV vector using the following primers: DNA2 pLenti‐F TTCCGGCTGCGTCCAGGATGGAGCAG and DNA2 pLenti‐R CTGGCTGCCTTATTCTCTTTGAAAGTCACCCAATATGTGG. After removal of the primers with the Qiagen PCR purification kit (cat# 28104), the cDNAs were in‐fusion (Clontech)‐cloned into a linearized pLenti PGK Hygro DEST vector that was generated by PCR using the primers pLenti‐ATTR2‐F GAATAAGGCAGCCAGTCTGCAGGTCGA and pLenti‐ATTR1‐R TGGACGCAGCCGGAAGCATAAAGTGTAAAGC. After transfection with the pLenti PGK Hygro DEST‐DNA2, the DNA2^Flox/−/− host cells survived hygromycin B selection for the complementation experiments shown in Figs 3 and 4.