Applied cfx96 real time pcr system

Total RNA extracts were obtained using TRIzol reagent (Invitrogen), and 1 μg of total RNA was used to synthesize cDNA (TaKaRa, Japan). qPCR was performed using the SYBR Green system (Bio‐Rad, Hercules, USA). Amplification of cDNA samples was carried out at 95°C for 3 min. followed by 40 cycles of 95°C for 15 sec. and 60°C for 45 sec. on an Applied CFX96^® real‐time PCR system (Bio‐Rad). The relative quantification of target genes was normalized to housekeeping gene β‐actin, and target genes were compared to each corresponding target gene from the control sample using the 2^−ΔΔCT method. The primers for VEGF‐A, KDR, PECAM‐1 and β‐actin are listed as follows: VEGF‐A (F) 5′‐AGCGGAGAAAGCATTTGTTTG‐3′, (R) 5′‐AACGCGAGTCTGTGTTTTTGC‐3′; KDR (F) 5′‐CACCATGCAGACGCTGACAT‐3′, (R) 5′‐TCTAGCTGCCAGTACCATTGGA‐3′; PECAM‐1 (F) 5′‐GCCCTGTCAC GTTTCAGTTT‐3′, (R) 5′‐CCACGGAGCAAGAAAGACTC‐3′; VE‐cadherin (F) 5′‐GTAACCCTGTAGGGAAAGAGTCCATT‐3′, (R) 5′‐GCATGCTCCCGATTAAA CTGCCCATA‐3′; β‐actin (F) 5′‐AACACCCCAGCCATGTACGTA‐3′, (R) 5′‐TCT CCGGAGTCCATCACAATG‐3′.

Total RNA extracts were obtained using TRIzol reagent (Invitrogen), and 1 μg of total RNA was used to synthesize cDNA (TaKaRa, Osaka, Japan). qPCR was performed using SYBR Green (Bio‐Rad, Hercules, USA). The cDNA samples were amplified on an Applied CFX96^® real‐time PCR system (Bio‐Rad) under the following conditions: 95°C for 3 min., followed by 40 cycles of 95°C for 15 sec. and 60°C for 45 sec. The relative expression levels of the target genes were normalized to those of the housekeeping gene GAPDH, and the target genes from the experimental group were compared with the corresponding target genes from the control group using the 2^−ΔΔCT method. The primers for iNOS, TNF‐α, COX‐2, Arg‐1 and GAPDH are listed in Table 1.