The largest database of trusted experimental protocols

Primescript rt reagent kit with cdna

Manufactured by Takara Bio
Sourced in Japan, China

The PrimeScript RT reagent Kit with cDNA is a laboratory tool used for the reverse transcription of RNA into complementary DNA (cDNA). It contains the necessary reagents and enzymes required for this process.

Automatically generated - may contain errors

2 protocols using primescript rt reagent kit with cdna

1

Quantitative RT-PCR for Liver Genes

Check if the same lab product or an alternative is used in the 5 most similar protocols
The primers used for real-time quantitative reverse transcription (RT)-PCR are depicted in S1 Table. Total RNA was extracted from the liver using the PrimeScript RT reagent Kit with cDNA (TaKaRa, MN, Japan) according to the manufacturer’s instructions. Total RNA (1 μg) was treated with DNase I and used for the RT reaction. The synthesized cDNA was stored at -20°C until further use. Real-time quantitative (q) RT-PCR was performed with the iCycler iQ system (ABI, MN, USA) and the SYBR Green I fluorescence kit (Sigma, MN, USA) according to the manufacturer's instructions. Amplification of mRNAs was performed in duplicate in a 96-well PCR reaction plate (ABI, MN, USA). The following real-time qRT-PCR protocol was used: cDNA was denatured at 95°C for 5 min to activate the Hot-start Taq DNA polymerase. The amplification and quantification program was repeated 40 times (95°C for 30 s, 95°C for 5 s, and 65°C for 31 s).The mRNA expression of GHR, IGF-1, IGFBP-1 and IGFBP-3 was measured using the 2-△△CT method.
+ Open protocol
+ Expand
2

Melanoma RNA Extraction and Quantification

Check if the same lab product or an alternative is used in the 5 most similar protocols
With the use of TRIzol reagent (Invitrogen, Hangzhou, Zhejiang, China), the extraction of total RNA from melanoma specimens and matched nontumor tissues was carried out based on the standard procedures provided by the company. A PrimeScript RT Reagent Kit with cDNA eraser (Takara Biotech, Pudong, Shanghai, China) was used for cDNA synthesis with one microgram of total RNA as a template. RT-PCR was carried out using cDNA primers specific for LINC00173 and mRNA. GAPDH was used as an internal control for LINC00173. Primers for LINC00173 were purchased from Genecopoeia (Xuhui, Shanghai, China). LINC00173: Forward GCCAGCTCTCGGTACCTGGA, LINC00173: Reverse GGATCGCAACATTCCTGCCAAG; GAPDH: ForwardCAAGGTCATCCATGACAACTTTG, GAPDH: ReverseGTCCACCACCCTGTTGCTGTAG.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!