Log In Sign up
The largest database of trusted experimental protocols

β galactosidase assay kit

Manufactured by Promega
Visit Supplier
Sourced in United States

The β-galactosidase assay kit is a laboratory tool used to measure the activity of the β-galactosidase enzyme. The kit provides the necessary reagents and protocols to quantify the levels of β-galactosidase in various sample types.

Automatically generated - may contain errors

Lab products found in correlation

Luciferase assay kit, by Promega (4 mentions) Lipofectamine 2000, by Thermo Fisher Scientific (3 mentions) Luciferase assay, by Promega (1 mentions) Penicillin, by Thermo Fisher Scientific (1 mentions) Streptomycin, by Thermo Fisher Scientific (1 mentions) Mcf 7, by National Centre for Cell Science (1 mentions) Hek 293 cells, by National Centre for Cell Science (1 mentions) Dulbecco modified eagle medium (dmem), by Thermo Fisher Scientific (1 mentions) Cell culture lysis buffer, by Promega (1 mentions) Glomax 96 microplate luminometer, by Promega (1 mentions) Dual luciferase reporter assay kit, by Promega (1 mentions) Extremegene 9 transfection reagent, by Roche (1 mentions) Opti mem reduced serum media, by Thermo Fisher Scientific (1 mentions) Reporter lysis buffer, by Promega (1 mentions) Steady glo luciferase assay system, by Promega (1 mentions) Pgl3 basic, by Promega (1 mentions) Lipofectamine 2000, by Merck Group (1 mentions) Luciferase reporter assay kit, by Promega (1 mentions)

Close spelling variants of this product

β-galactosidase enzyme assay kit PSV-β-galactosidase vector and luciferase assay kit β-galactosidase enzyme assay kit with reporter lysis buffer β-galactosidase

10 protocols using β galactosidase assay kit

1

Transcription Factor Response Element Assay

Check if the same lab product or an alternative is used in the 5 most similar protocols
The transcription factor response element activity was assessed with luciferase constructs bearing response elements for STAT1 (4xGAS response element; Stratagene, #219091–51), STAT1/STAT2 (IRSE/interferon alpha response element66 (link)) and STAT3 (4xm67 response element67 (link)). A CMV-β-gal plasmid was co-transfected as a control of transfection efficiency. Forty-eight hours post transfection cells were stimulated with 10 nm human EGF (Roche; #11376454001) for 5 h before luciferase and β-gal activity were measured using luciferase assay (Promega, #E4030) and β-galactosidase assay kits (Promega, #E2000). Luciferase activity was normalized againstβ-gal activity to correct for transfection efficiency.
Kennedy S.A., Jarboui M.A., Srihari S., Raso C., Bryan K., Dernayka L., Charitou T., Bernal-Llinares M., Herrera-Montavez C., Krstic A., Matallanas D., Kotlyar M., Jurisica I., Curak J., Wong V., Stagljar I., LeBihan T., Imrie L., Pillai P., Lynn M.A., Fasterius E., Al-Khalili Szigyarto C., Breen J., Kiel C., Serrano L., Rauch N., Rukhlenko O., Kholodenko B.N., Iglesias-Martinez L.F., Ryan C.J., Pilkington R., Cammareri P., Sansom O., Shave S., Auer M., Horn N., Klose F., Ueffing M., Boldt K., Lynn D.J, & Kolch W. (2020). Extensive rewiring of the EGFR network in colorectal cancer cells expressing transforming levels of KRASG13D. Nature Communications, 11, 499.
+ Open protocol
+ Expand
2

Comparative Cell Culture Study

Check if the same lab product or an alternative is used in the 5 most similar protocols
MCF-7 (non-metastatic breast cancer cell line), U-87 (most aggressive malignant primary brain cancer cell line) and HEK293 cells (Normal human embryonic kidney cells) are obtained from National Centre for Cell Science (NCCS); Pune, INDIA. Cells are cultured in Dulbecco's modified Eagle's medium (DMEM; Gibco, USA). Culture medium is supplemented with 10% Fetal Bovine Serum (FBS) and 100 units/ml Streptomycin and Penicillin from GIBCO laboratories, Grand Island, NY, USA). [ 3 H] thymidine is procured from the Baba Atomic Research Centre, Mumbai, India. Mammalian transfection assay kits, luciferase, CAT and β-galactosidase assay kits are from Promega, USA. All other reagents used are of the highest analytical grade.
Shilpa P., Kaveri K, & Salimath B.P. (2015). Anti-metastatic action of anacardic acid targets VEGF-induced signalling pathways in epithelial to mesenchymal transition. Drug discoveries & therapeutics, 9(1).
+ Open protocol
+ Expand
3

Quantifying TGF-β1 Induced β-Galactosidase

Check if the same lab product or an alternative is used in the 5 most similar protocols
The experiments were performed according to the manufacture’s protocol of the β-galactosidase assay kit (Promega) for TGF-β1 transfected hDPSCs and non-transfected hDPSCs on the 7th day. Briefly, cell lysates were prepared with 1× reporter lysis buffer (RLB); and 150 μl of lysates were added into each well; and then, 150 μl Assay 2× buffer was added into each well. The incubated reactions were continued at 37°C until a faint yellow color developed. The reaction was stopped by adding 150 μl of 1M sodium carbonate. The absorbance was read at 420 nm.
Salkın H., Gönen Z.B., Ergen E., Bahar D, & Çetin M. (2018). Effects of TGF-β1 Overexpression on Biological Characteristics of Human Dental Pulp-derived Mesenchymal Stromal Cells. International Journal of Stem Cells, 12(1), 170-182.
+ Open protocol
+ Expand
4

Transcriptional Regulation Assay in HEK293T Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
HEK293T cells were co-transfected with five or six plasmids: (1) pG5E1B-luc, 0.3 μg; (2) pCMV-LacZ, 0.1 μg; (3) pMst-AβPP (AβPP-Gal4), 0.3 μg; (4) pCMV5-TrkA or pCMV5-TrkA(K538A), 1.0 μg; (5) pcDNA4-His-MaxB-hYAP1 or pCMV-Fe65, 1.0 μg. Where indicated, a sixth plasmid was co-transfected: pCMV5-Mint3, 1.0 μg. For negative controls, the expression vector pcDNA3 was used without insert. Cells were harvested 48 h after transfection in 0.2 ml per well Cell Culture Lysis Buffer (Promega), and their luciferase and β-galactosidase activities were determined with the Promega luciferase assay kit and the Promega β-galactosidase assay kit, respectively. The luciferase activity was standardized by the β-galactosidase activity to control for transfection efficiency and general effects on transcription. Values shown are averages of transactivation assays performed in duplicate or triplicate and repeated at least three times for each constructs combination. All constructs were assayed in HEK293T and B103 cell lines, and representative results from the HEK293T cell lines are shown. Transfections were performed at 80–90% confluency in six-well plates using Lipofectamine 2000 (Invitrogen).
Zhang Q., Descamps O., Hart M.J., Poksay K.S., Spilman P., Kane D.J., Gorostiza O., John V, & Bredesen D.E. (2014). Paradoxical Effect of TrkA Inhibition in Alzheimer’s Disease Models. Journal of Alzheimer's disease : JAD, 40(3), 605-617.
+ Open protocol
+ Expand
5

NF-κB Activation Assay in CHIKV Infection

Check if the same lab product or an alternative is used in the 5 most similar protocols
For reporter assay, HEK 293T cells were seeded in 6-well culture dishes until ∼70% confluency and transfected with 2 µg of NF-κB -FLuc plasmid (a kind gift from Dr. Adolfo Garcia Sastre, Mount Sinai School of Medicine, New York, USA) using Lipofectamine 2000 as per the manufacturer’s protocol. For infection experiments, 6–8 hours post transfection, cells were infected with CHIKV at MOI 2 and harvested 32 hours post infection to measure luciferase activity. For microRNA over expression experiments, cells were co transfected with reporter clone of NF-κB and miR-146a/scramble miR-146a mimic and harvested 48 hours post transfection to measure the luciferase activity. In anti-miR experiment, 24 hour post transfection of reporter plasmids along with anti-miR-146a, cells were infected with CHIKV and lysates were prepared for luciferase activity. Luciferase activity was determined as relative light unit by using luciferase assay kit (Promega) according to the manufacturer’s protocol and normalized with β-galactosidase expression by β-galactosidase assay kit (Promega).
Selvamani S.P., Mishra R, & Singh S.K. (2014). Chikungunya Virus Exploits miR-146a to Regulate NF-κB Pathway in Human Synovial Fibroblasts. PLoS ONE, 9(8), e103624.
+ Open protocol
+ Expand
6

Regulation of WT1 Promoter Activity

Check if the same lab product or an alternative is used in the 5 most similar protocols
WT1 promoter vectors were a kind gift from Professor Dr. Takashi Murate (Department of Medical Technology, Nagoya University Graduate School of Heath Sciences, Japan). The WT1 promoter sequence, including the WT1 and c-Fos/AP-1 binding site, and 301 bp reporter constructs was inserted into the pGL3 basic vector. For the mutant pGL3 construct, core nucleotides of a potential WT1 binding site were altered using a Quick-Change Site Mutagenesis Kit with PCR primers for the WT1 consensus sequence located at -50 to-39; GTGTGGGAGCC [27 (link)] was mutated to ATATGATATCA. K562 cells were co-transfected with the construct vector and β-galactosidase (β-Gal) for 24 h and then treated with mammea E/BB. Co-transfected cells were lysed with lysis buffer. Luciferase activity of the lysis solution was measured using a Dual-Luciferase Reporter Assay Kit, β-galactosidase Assay Kit and a GloMax 96 Microplate Luminometer with dual injections (Promega, USA).
Rungrojsakul M., Katekunlaphan T., Saiai A., Ampasavate C., Okonogi S., Sweeney C.A, & Anuchapreeda S. (2016). Down-regulatory mechanism of mammea E/BB from Mammea siamensis seed extract on Wilms’ Tumor 1 expression in K562 cells. BMC Complementary and Alternative Medicine, 16, 130.
+ Open protocol
+ Expand
7

HIF-1 Transcriptional Activity Assay

Check if the same lab product or an alternative is used in the 5 most similar protocols
2.0X105 cells were seeded in 60 mm culture dishes 24 h prior to transfection. Cells were incubated overnight with transfection mixture containing 1.5 μg HIF-1 pTL-Luc (5’-3’: GTGACTACGTGCTGCCTAGGTGACTACGTGCTGCCTAGGTGACTACGT GCTGCCTAGGTGACTACGTGCTGCCTAG; Affymetrix, LR0128) and 0.1 μg pSV-β-galactosidase plasmids (Clontech) and eXtreme Gene 9 transfection reagent (Roche) following the manufacturers protocol in OptiMEM Reduced Serum media (Invitrogen). Transfection media was replaced with standard RPMI the following day, and cells treated as described. Luciferase activity was measured using the Luciferase Assay Kit (Promega) and normalized against β-galactosidase activity that was measured using the β-galactosidase Assay Kit (Promega). Luciferase and β-gal were measured separately on a SpectraMax M2e 96-well plate reader.
Miles S.L., Fischer A.P., Joshi S.J, & Niles R.M. (2015). Ascorbic acid and ascorbate-2-phosphate decrease HIF activity and malignant properties of human melanoma cells. BMC Cancer, 15, 867.
+ Open protocol
+ Expand
8

Transcriptional regulation of MUC4 gene

Check if the same lab product or an alternative is used in the 5 most similar protocols
To perform this assay, previously designed and established pGL3-MUC4 deletion constructs were used (Andrianifahanana et al., 2005 (link)). PC cell lines were plated in six-wells in triplicates and repeated thrice. Transient transfection was performed with MUC4 deletion constructs using lipofectamine 2000 (Life Technologies; Carlsbad, CA, USA). Next day, the media was first changed to 10% FBS containing DMEM for 12h (to alleviate cellular stress of transfected cells) and then to serum free media for additional 8h. Subsequently, transfected cells were treated with BA for 4h in serum free condition. Following treatment, cells were lysed using reporter lysis buffer (Promega; Madison, WI) and subsequently, the activity of luciferase and beta-galactosidase activity was measured using Steady-Glo Luciferase assay system (Promega, E2510) and β-galactosidase assay kit (Promega, E2000). Fold activation of luciferase activity in BA-treated cells were calculated and compared with untreated cells. In silico analysis was performed on designated MUC4 promoter region using ALGGEN PROMO software (where similarity score of >0.85 was used to screen transcription factor binding sites) to predict the binding of putative transcription factors.
Joshi S., Cruz E., Rachagani S., Guha S., Brand R.E., Ponnusamy M.P., Kumar S, & Batra S.K. (2016). Bile acids‐mediated overexpression of MUC4 via FAK‐dependent c‐Jun activation in pancreatic cancer. Molecular Oncology, 10(7), 1063-1077.
+ Open protocol
+ Expand
9

Promoter Activity Assay for BECLIN1 and MAP1LC3B

Check if the same lab product or an alternative is used in the 5 most similar protocols
The BECLIN1 (-644 to +197) and MAP1LC3B promoter (-965 to +118) were amplified from genomic DNA of AGS cells using primers given in Table S1. The resulting PCR products were cloned between the KpnI and HindIII sites of the vector pGL3 basic (Promega) harbouring the firefly luciferase gene. These promoter constructs were co-transfected into AGS cells along with βgalactosidase expressing construct using Lipofectamine 2000 (Invitrogen) according to the manufacturer's protocol. Cells were treated 24 h after transfection, lysed and luciferase activity was measured using the luciferase assay kit (Promega) according to the manufacturer's protocol. Luciferase activity was normalized by measuring β-galactosidase activity using the β-galactosidase assay kit (Promega).
Halder P., Datta C., Kumar R., Sharma A.K., Basu J, & Kundu M. (2015). The secreted antigen, HP0175, of Helicobacter pylori links the unfolded protein response (UPR) to autophagy in gastric epithelial cells. Cellular microbiology, 17(5).
+ Open protocol
+ Expand
10

Measuring COX-2 Luciferase Activity in SKGT-4 Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
SKGT-4 cells were transiently transfected with COX-2 luciferase constructs using Lipofectamine 2000, as described by the manufacturer (Sigma). Twenty-four hours before transfection, cells were seeded in 24-well plates at a density of 50,000 cells per well. The following day, the cells were transfected with the reporter plasmids (5 µg) and exposed to DCA 300 μM or pH 6.8 for 15 h. Luciferase and β-galactosidase activities were measured in cell lysates (50 µl) in a nontransparent 96-well plate using a luciferase reporter assay kit (Promega) and a β-galactosidase assay kit (Promega) according to the manufacturer's instructions, and readout was quantified by luminescence. Transfection efficiency was determined by normalizing luciferase activity of each sample to β-galactosidase activity and the results are presented as means ± SD.
Abdel-Latif M.M., Inoue H., Kelleher D, & Reynolds J.V. (2016). Factors regulating nuclear factor-kappa B activation in esophageal cancer cells: Role of bile acids and acid. Journal of cancer research and therapeutics, 12(1).
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!