A single colony was incubated in 5ml sterile LB medium with 100ng/ml Kanamycin in a 15 ml falcon tube at 37°C with agitation at 250 rpm overnight. Bacteria were harvested directly by centrifuging at 2500 rpm for 15min. Plasmid extraction was carried out using QIAprep Miniprep plasmid kit (Qiagen) according to the manufacturer’s instructions. The eluted DNA was quantified by a nanodrop spectrophotometer and stored at -20°C until further use.
Qiaprep plasmid miniprep kit
Manufactured by Qiagen
Sourced in Germany
The QIAprep plasmid Miniprep kit is a laboratory equipment designed for the rapid and efficient purification of plasmid DNA from bacterial cultures. It utilizes a simple and reliable spin-column procedure to isolate high-quality plasmid DNA suitable for various downstream applications.
Automatically generated - may contain errors
Lab products found in correlation
Qiaquick pcr purification kit, by Qiagen (5 mentions)
Escherichia coli dh5α, by New England Biolabs (3 mentions)
Lb lennox, by Thermo Fisher Scientific (2 mentions)
Ampicillin, by Merck Group (2 mentions)
Q5 polymerase, by New England Biolabs (2 mentions)
Casein peptone, by Thermo Fisher Scientific (2 mentions)
Sodium chloride (nacl), by Thermo Fisher Scientific (2 mentions)
Pgem 5zf, by Promega (1 mentions)
E coli dh5α, by New England Biolabs (1 mentions)
Stbl3 bacteria, by Thermo Fisher Scientific (1 mentions)
Pspcas9n bb 2a gfp px461, by Addgene (1 mentions)
T4 ligase, by Thermo Fisher Scientific (1 mentions)
9 protocols using qiaprep plasmid miniprep kit
1
Plasmid Extraction from Bacterial Cultures
2
Amplifying TbCDS Flanking Regions
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The 5′ and 3′ UTRs immediately adjacent to the TbCDS open reading frame were amplified from T. brucei genomic DNA using KOD polymerase. The primers 5′‐ATAAGTAAGCGGCCGC TGATTAACGCACCC‐3′ and 5′‐CGTTTAAACTTACGGACCGTCAAGCTT CTAGACGCTTTCACTGAAAAATGC‐3′ were used for the 5′ untranslated region (UTR), amplifying the expected 516 bp product and primers 5′‐TGACGGTCCGTAAGTTTAAACGGATCC TCCATGTTGGAAGGGCACG‐3′ and 5′‐AGTAAGCGGCCGC CCTTGAAAACAATGGTGTATAC‐3′ resulted in the correct 179 bp 3′ UTR product.
These amplified products were used in a knitting PCR, resulting in a 695 bp product in which the 5′ UTR was joined to the 3′ UTR via a short BamHI–HindIII linker region contained within the described primers (italics) and a NotI site (underlined) at each end. This PCR product was ligated into pGEM‐5Zf(+) (Promega) using NotI sites, and the hygromycin (HYG) or puromycin (PAC) resistance genes were ligated between the BamHI and HindIII restriction sites. Plasmid DNA was prepared using a QIAprep Miniprep Plasmid Kit (Qiagen). After digestion with NotI the DNA was precipitated with sodium acetate/ethanol and dissolved in sterile water to a final concentration of 1 μg μl−1.
These amplified products were used in a knitting PCR, resulting in a 695 bp product in which the 5′ UTR was joined to the 3′ UTR via a short BamHI–HindIII linker region contained within the described primers (italics) and a NotI site (underlined) at each end. This PCR product was ligated into pGEM‐5Zf(+) (Promega) using NotI sites, and the hygromycin (HYG) or puromycin (PAC) resistance genes were ligated between the BamHI and HindIII restriction sites. Plasmid DNA was prepared using a QIAprep Miniprep Plasmid Kit (Qiagen). After digestion with NotI the DNA was precipitated with sodium acetate/ethanol and dissolved in sterile water to a final concentration of 1 μg μl−1.
3
Molecular Cloning of mCherry in E. coli
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Experiments were performed in E. coli DH5-α (NEB), grown in LB-Lennox (Oxoid) (10-g/L casein peptone, 5-g/L yeast extract, 5-g/L NaCl with additional 15-g/L agar for plates) supplemented with 100-µL/mL ampicillin (Sigma-Aldrich). PCR amplifications were performed using Q5 polymerase (NEB). All other necessary enzymes were also purchased from NEB. Primers were ordered from Eurofins Genomics – Sigma-Aldrich. Plasmids and PCR products were purified using the QIAprep Plasmid Miniprep Kit and QiaQuick PCR Purification Kit, respectively (Qiagen). Plasmid Sanger sequencing was performed by Eurofins Genomics. The E. coli codon-optimized sequence of mCherry was a gift from Yanina R. Sevastsyanovich (University of Birmingham).
4
Site-Directed Mutagenesis of ChoA Gene
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Primers
were designed to incorporate each mutation into template plasmid pCO117
(a PKK223-3 derivative) containing the wild-type Streptomyces ChoA gene27 (link) via site-directed mutagenesis
PCR (Table S1 ). Methylated template DNA
was digested with DpnI for 1.5 h at 37 °C and
then inactivated by being heated for 20 min at 80 °C. The remaining
PCR products were transformed into XL1 Blue cells and grown overnight
at 37 °C on Luria Broth (LB)-agar (200 μg/mL ampicillin)
plates. A single colony was picked and grown in 10 mL of LB medium
(200 μg/mL ampicillin) overnight at 37 °C. Plasmids were
purified from the culture by means of a Qiagen QIAprep Plasmid Mini-Prep
Kit. Purified plasmid DNA was sequenced to verify the presence of
the desired mutation.
were designed to incorporate each mutation into template plasmid pCO117
(a PKK223-3 derivative) containing the wild-type Streptomyces ChoA gene27 (link) via site-directed mutagenesis
PCR (
was digested with DpnI for 1.5 h at 37 °C and
then inactivated by being heated for 20 min at 80 °C. The remaining
PCR products were transformed into XL1 Blue cells and grown overnight
at 37 °C on Luria Broth (LB)-agar (200 μg/mL ampicillin)
plates. A single colony was picked and grown in 10 mL of LB medium
(200 μg/mL ampicillin) overnight at 37 °C. Plasmids were
purified from the culture by means of a Qiagen QIAprep Plasmid Mini-Prep
Kit. Purified plasmid DNA was sequenced to verify the presence of
the desired mutation.
5
CRISPR Knockout with Cas9 Nickase
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
CRISPR knockout experiments were performed with Cas9 nickase (Cas9n) enzymes guided by paired sgRNA sequences to mitigate off-target effects as previously described [37 (link)]. Paired sgRNA sequences targeting IL2RG on the X-chromosome were designed using the MIT CRISPR Design Tool ( crispr.mit.edu ) and synthesized by Integrated DNA Technologies: Pair 1: 5’-TCTTAGTCCTTCAGCTGCTC-3’, 5’-GAGGGCAGGGTGGAGCTCCA-3’. Pair 2: 5’-TCCAGAGGTTCAGTGCTTTG-3’, 5’-TAGAGTACATGAATTGCACT-3’. SgRNA oligonucleotides were annealed and ligated into digested pSpCas9n(BB)-2A-GFP (PX461) (Addgene, Cambridge, MA) in 1 μl px461 (100 ng), 2 ul 10x Fast-Digest buffer, 1 μl each of annealed oligonucleotides (0.5 μM), Bbs1 Fast-Digest, T4 Ligase (all ThermoFisher Scientific), 14 μl ddH20 and incubated in a 37°C water bath for 2 hours and then transformed into Stbl3 bacteria by heat shock (ThermoFisher Scientific). Bacteria were selected ampicillin resistance (100 μg/ml) and harvested for plasmid (QIAprep Plasmid Miniprep kit Qiagen, Germantown, MD). Harvested plasmid was Sanger sequenced to confirm appropriate insertion.
6
Cloning of PCR Products
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The PCR products were purified by using QIAquick PCR Purification Kit (Qiagen, Hilden, Germany). The eluted PCR products were cloned into the pTG19 vector according to routine protocol. Then, it was transformed into E. coli DH5. The pTG19 plasmid was extracted using the QIAprep® plasmid Miniprep Kit (Qiagen, Hilden, Germany) and serially diluted from cultured E. coli DH5 in LB broth containing 100 μg/ml ampicillin, 40 μg/ml X-Gal, and 40 μg/ml IPTG.
7
Escherichia coli Cloning and Protein Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Escherichia coli DH5-α
(New England Biolabs) was used as the cloning and testing strain in
this work. Escherichia coli BL21 was used as the
protein expression strain for downstream protein purification. Cells
were grown in LB-Lennox (10 g/L casein peptone (Oxoid, ThermoFisher
Scientific), 5 g/L yeast extract (Oxoid, ThermoFisher Scientific),
and 5 g/L NaCl (VWR) supplemented with 15 g/L agar (Oxoid, ThermoFisher
Scientific) for agar plates) supplemented with the appropriate antibiotics
(Sigma-Aldrich). All enzymes were purchased from New England Biolabs.
Primers were ordered from Eurofins Genomics or Sigma-Aldrich (primer
list:Table S1 ). PCR reactions were performed
with Q5 polymerase (NEB) unless specified otherwise. Colony PCR reactions
were performed with the Taq polymerase (NEB). A QiaQuick
PCR purification kit (Qiagen) and a QIAprep plasmid Miniprep kit (Qiagen)
were used for the purification of PCR products and plasmid DNA, respectively.
DNA sequences were confirmed by Sanger sequencing performed by Eurofins
Genomics.
(New England Biolabs) was used as the cloning and testing strain in
this work. Escherichia coli BL21 was used as the
protein expression strain for downstream protein purification. Cells
were grown in LB-Lennox (10 g/L casein peptone (Oxoid, ThermoFisher
Scientific), 5 g/L yeast extract (Oxoid, ThermoFisher Scientific),
and 5 g/L NaCl (VWR) supplemented with 15 g/L agar (Oxoid, ThermoFisher
Scientific) for agar plates) supplemented with the appropriate antibiotics
(Sigma-Aldrich). All enzymes were purchased from New England Biolabs.
Primers were ordered from Eurofins Genomics or Sigma-Aldrich (primer
list:
with Q5 polymerase (NEB) unless specified otherwise. Colony PCR reactions
were performed with the Taq polymerase (NEB). A QiaQuick
PCR purification kit (Qiagen) and a QIAprep plasmid Miniprep kit (Qiagen)
were used for the purification of PCR products and plasmid DNA, respectively.
DNA sequences were confirmed by Sanger sequencing performed by Eurofins
Genomics.
8
Molecular Cloning of mCherry in E. coli
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Experiments were performed in Escherichia coli DH5-α (NEB), grown in LB-Lennox (Oxoid) (10 g/L casein peptone, 5 g/L yeast extract, 5 g/L NaCl with additional 15 g/L agar for plates) supplemented with 100 µg/mL ampicillin (Sigma-Aldrich). PCR amplifications were performed with Q5 polymerase (NEB). All other necessary enzymes were also purchased from NEB. Primers were ordered from Eurofins Genomics and Sigma-Aldrich. Plasmids and PCR products were purified with QIAprep plasmid Miniprep kit and QiaQuick PCR purification kit respectively (Qiagen). Plasmid Sanger sequencing was performed by Eurofins Genomics. The E. coli codon-optimized sequence of mCherry was a gift from Yanina R. Sevastsyanovich (University of Birmingham).
9
Cloning and Protein Expression Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Escherichia coli DH5-α (New England Biolabs) was used as the cloning and testing strain in this work.
Escherichia coli BL21 was used as the protein expression strain for downstream protein purification.
Cells were grown in LB-Lennox (10 g/L casein peptone (Oxoid, ThermoFisher Scientific), 5 g/L yeast extract (Oxoid, ThermoFisher Scientific), 5 g/L NaCl (VWR) and supplemented with 15 g/L agar (Oxoid, ThermoFisher Scientific) for agar plates) supplemented with the appropriate antibiotics (Sigma-Aldrich). All enzymes were purchased from New England Biolabs. Primers were ordered from Eurofins Genomics or Sigma-Aldrich (primer list: Supplementary Table S1). PCR reactions were performed with Q5 polymerase (NEB) unless specified otherwise. Colony PCR reactions were performed with Taq polymerase (NEB). QiaQuick PCR purification kit (Qiagen) and QIAprep plasmid Miniprep kit (Qiagen) were used for the purification of PCR products and plasmid DNA respectively. DNA sequences were confirmed by Sanger sequencing performed by Eurofins Genomics.
Escherichia coli BL21 was used as the protein expression strain for downstream protein purification.
Cells were grown in LB-Lennox (10 g/L casein peptone (Oxoid, ThermoFisher Scientific), 5 g/L yeast extract (Oxoid, ThermoFisher Scientific), 5 g/L NaCl (VWR) and supplemented with 15 g/L agar (Oxoid, ThermoFisher Scientific) for agar plates) supplemented with the appropriate antibiotics (Sigma-Aldrich). All enzymes were purchased from New England Biolabs. Primers were ordered from Eurofins Genomics or Sigma-Aldrich (primer list: Supplementary Table S1). PCR reactions were performed with Q5 polymerase (NEB) unless specified otherwise. Colony PCR reactions were performed with Taq polymerase (NEB). QiaQuick PCR purification kit (Qiagen) and QIAprep plasmid Miniprep kit (Qiagen) were used for the purification of PCR products and plasmid DNA respectively. DNA sequences were confirmed by Sanger sequencing performed by Eurofins Genomics.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!