Magmax total rna isolation kit

Rectal swabs were collected by inserting Dacron swab 3–5 cm into piglet’s rectum and rotating it against the rectal wall several times in the PRVC Cowden G1, RV0104, and RV0143 inoculated Gn pigs and mock pigs. Rectal swabs were processed by submerging the swabs into 2 mL of MEM-Gibco supplemented with 1% antibiotic-antimycotic (Anti-Anti; Life Technologies, Grand Island, NY, United States). Centrifugation was performed at 1,800 × g for 20 min at 4°C. Genomic RNA was extracted from rectal swab supernatants (50 μl) using MagMAX total RNA isolation kit (Life Technologies, Grand Island, NY, United States) according to the manufacturers protocol. RT-qPCR was performed using One-step RT-PCR Kit (Qiagen, Germantown, MD) using the following primer set and probe: RVC forward primer-5′ ATGTAGCATGATTCACGAATGGG 3′, RVC reverse primer-5′ ACATTTCATCCTCCTGGGGATC 3′, and Probe 5′-VIC-GCGTAGGGGCAAATGCGCATGA-TAMRA-3′. RT-qPCR conditions were as follows: reverse transcription at 50°C for 30 min, initial PCR activation at 95°C for 15 min, 40 amplification cycles with denaturation at 94°C for 1 min, annealing at 55°C for 1 min, extension at 72°C for 1 min, and final extension at 72°C for 10 min (Marthaler et al., 2014 (link)). PRVC shedding titers were calculated using the RT-PCR standard curve as described earlier.

Distal colon samples submerged in RNAlater were removed from -20° C and trimmed to a total weight of 33mg. After weighing, tissue samples were transferred into 1ml of TRIzol solution. A plastic tissue cutter was placed into each sample tube for tissue homogenization using an Omni AH96 homogenizing workstation (Omni International). Samples were homogenized at 20,000 rpm for 2 min. RNA was extracted using the MagMax Total RNA Isolation kit (Life Technologies) following the supplier’s provided protocol, and the resulting RNA was quantified using a standard protocol. Briefly, 2μl of RNase free water was added to each sample and then the sample was placed in a Nanodrop 8000 spectrophotometer (Thermo Scientific) for quantification. RNA quality was determined using a QIAxcel RNA quality control kit (Qiagen) following the manufacturer’s protocol.

RNA was isolated from gamma-irradiated whole blood using MagMax Total RNA Isolation Kit (Life Technologies, Grand Island, NY). qRT-PCR of RNA was conducted with established primer and probe sets for the RVFV L segment [23 (link)]. A standard curve, expressed as tissue culture infective dose 50 (TCID₅₀)/mL, was generated from normal human whole blood spiked with a wild-type RVFV stock. The standard curve was used to convert raw Ct values to relative TCID₅₀/mL.

Total RNA from various specimens were performed using Magmax Total RNA Isolation kit (Life Technologies). The amplification of a 983 bp fragment from the polyprotein gene in the VP1 region was adopted from the conventional RT-PCR as previously described [http://www.europic.org.uk/Europic2006/posters/Knowles.svv.01.pdf]. Forward (SVV-1C556F) and reverse (SVV-2A22R) primers were added at concentrations of 40 pmol and 80 pmol respectively, in a mixture of Superscript III One Step RT-PCR w/ Platinum Taq HiFi (Invitrogen) for reverse transcription, and cycling amplification of: 30 min at 42°C, 2 min at 94°C, followed by 40 cycles of 15 sec at 94°C, 30 sec at 55°C and 1 min at 72°C.

Liver, spleen, kidney, GIT, brain and blood specimens were collected on days 1, 4, 6 and 7 post-infection, and from animals reaching experimental end points. RNA was extracted using MagMax Total RNA Isolation kit (Ambion). Approximately 100 mg tissue samples were placed directly in lysis buffer and homogenized using a high throughput tissue grinder (GenoGrinder2000). Homogenates were extracted using the MagMax Express-96 Magnetic Particle Processor (Ambion) according to manufacturer's directions including a DNase treatment step. Approximately 50 mL of whole blood was added directly to lysis buffer with isopropanol and extracted using the MagMax Express-24 Magnetic Particle Processor (Ambion) following manufacturer's protocol.

The anti-NoV activity of compounds herein prepared was evaluated at 10 μM following previously reported methods [21 (link),22 (link)]. Briefly, HG23 replicon cells, kindly provided by Kyeong-Ok Chang, Kansas State University (Manhattan, KS, USA), were seeded at a density of 1.6 × 10⁴ cells/well in 96-well plates and incubated at 37 °C and 5% CO₂ overnight. Compounds were tested at 10 µM. Compounds were added in triplicate to 80–90% confluent monolayers and incubated at 37 °C and 5% CO₂. Untreated cells were incubated in each plate. At 24, 48, 72 and 96 h post-treatment, total RNA was extracted using the Mag-Max Total RNA Isolation kit (Ambion, Austin, TX, USA) and NV replicon RNA was quantified by GI NoV Taqman real-time RT-PCR (NoV RT-qPCR). Protein expression levels were monitored by western blot analysis.