Esp3i

Individual oligonucleotides were cloned in the CRISP-seq backbone (Supplementary Table 2) using a Golden-Gate reaction with a 100-ng vector backbone, 1 μl annealed sgRNA oligonucleotides, 1 μl Esp3I (New England Biolabs) and 1 μl T4 DNA Ligase (New England Biolabs) using the following program: 10× (5 min at 37 °C, 10 min at 22 °C), 30 min at 37 °C and 15 min at 75 °C. Individual colonies were picked and grown in lysogeny broth and ampicillin overnight. Plasmids were isolated with the ZymoPURE MiniPrep Kit (Zymo Research) and sequenced using a U6 forward primer (Supplementary Table 8).

Restriction enzyme cloning was accomplished using: BsaI-HFv2 (New England Biolabs, #R3733), Esp3I (New England Biolabs, R0734) and T4 Ligase (Promega, M1801). PCR was performed using proofreading enzymes iProof High-Fidelity DNA Polymerase (Biorad, #1725301), Phusion High-Fidelity DNA Polymerase (New England Biolabs, M0530), or Q5 High-Fidelity DNA Polymerase (New England Biolabs, M0491). Molecular biology experiments, including in silico designs and experimentation, as well as plasmid maps, were designed using SnapGene software (https://www.snapgene.com:443/products/snapgene/) (GSL Biotech LLC). All plasmids developed in this project are listed in Tables S1 and S2 and the Key resources table.

The MPRA oligo library was amplified using Q5 High-Fidelity DNA Polymerase (NEB). The amplified library was size-selected using Agencourt AMPureXP beads (Beckman Coulter). The oligo library was then inserted into an empty MPRA vector by golden gate assembly using BsaI (NEB) and T4 Ligase (NEB). The resulting library was purified using isopropanol precipitation (15 µL elute) then expanded by electroporation into 5 vials (3 µL ligation/vial) of One Shot TOP10 Electrocomp E. coli (ThermoFisher). The plasmid library was isolated using the Plasmid Plus Maxi kit (QIAGEN). The MPRA reporter gene (SV40 promoter followed by GFP) was then incorporated into the plasmid library by golden gate assembly using Esp3I (NEB) and T4 Ligase (NEB). The final MPRA plasmid library was purified, expanded, and isolated as described previously. Primers and PCR conditions are listed in Supplemental Table S6.

HuH7, Caco-2, Calu-3, HuH7.5.1, VeroE6, HepG2, and HEK293T cells were cultured in DMEM supplemented with 10% fetal bovine serum (FBS) and penicillin/streptomycin (Thermo Fisher Scientific, Waltham MA). CRISPR constructs were generated by cloning an ACE2-targeting gRNA sequence [TACCAAGCAAATGAGCAGGG] or a nontargeting control gRNA sequence [CGTGTGTGGGTAAACGGAAA] into Esp3I (New England Biolabs, Ipswich MA) sites of the pLentiCRISPRv2 backbone (Addgene, Watertown MA, #52961, gifted by Feng Zhang). An ACE2 overexpression construct was generated by HiFi DNA assembly (New England Biolabs #E2621) of the human ACE2 coding sequence (Sino Biological, Beijing China, #HG10108-M) into LeGO-iC2 (Addgene #27345, gifted by Boris Fehse) with simultaneous replacement of mCherry with a blasticidin resistance cassette. Lentivirus was generated and used to genetically engineer cell lines as previously described^{59 (link)}. Primers used for qRT-PCR were: ACE2-fwd [5′-AAACATACTGTGACCCCGCAT-3′], ACE2-rev [5′-CCAAGCCTCAGCATATTGAACA-3′], ACTB-fwd [5′-CCCTGGACTTCGAGCAAGAG-3′], ACTB-rev [5′-ACTCCATGCCCAGGAAGGAA].

We constructed overexpression vectors for DNAAF5, PFKL and USP39 genes using pCDNA3.1-puro-Flag, pCDNA3.1-G418-myc and pCDNA3.1-Hygro-HA plasmids, respectively. The extracted RNA was reverse transcribed to cDNA using the HiScript III 1^st Strand cDNA Synthesis Kit (+gDNA wiper) (Vazyme Biotech Co., Ltd), after which the corresponding fragment was amplified using 2 × Phanta Flash Master Mix (Dye Plus) (Vazyme Biotech Co., Ltd) and a ClonExpress II One The Step Cloning Kit (Vazyme Biotech Co., Ltd) to ligate the fragment to the corresponding vector. Complete plasmids were used for subsequent experiments after sequences had been verified to be correct.
The LentiCRISPRv2 plasmid was digested using Esp3I (R0734, NEB), after which the annealed primer fragment was ligated into it using T4 ligase (M0202, NEB).
The PLKO.1-Hygro vector was used to silence the corresponding gene. After double-digestion with AgeI-HF (R3552, NEB) and EcoRI-HF (R3101, NEB), T4 ligase (M0202, NEB) was used to link the annealed primer fragments into the vector.
Depending on the progress and needs of the experiment, the Lipo8000 (C0533, Beyotime) transfection reagent was used to transfer different plasmids into various cells after which corresponding antibiotics were added to screen and obtain equivalent stable cell lines.

The guide (g)RNA sequence targeting Homo sapiens KRIT1 (5′-GTATTCCCGAGAATTGAGACTGG-3′) was selected based on the Zhang lab online gRNA prediction tool (http://crispr.mit.edu/). The gRNA was subsequently cloned in lentiCRISPRv2 vector (Addgene; 52961), flanked by Esp3I (New England Biolabs; R0734) restriction sites. Lentiviral particles were produced in HEK 293T cells, which were co-transfected with the gRNA containing lentiCRISPRv2 vector together with the packaging vectors pMDLg/pRRE (Addgene; 12251), pRSV-Rev (Addgene; 12253), and pMD2.G (Addgene; 12259) using polyethyleneimine (Sigma Aldrich; 764604) as a transfection reagent. Supernatants containing viral particles were collected 48 and 72 h post transfection, concentrated with Lenti-X concentrator (Clontech; 631232) and used to infect HUVECs. Transduced HUVECs were selected with 1 μg/ml Puromycin (Sigma Aldrich; P8833).