Protein a g agarose beads

Cells were grown to about 70% confluency, then washed twice with 1xPBS, and collected in CHAPS buffer (25 mM HEPES, 2 mM EGTA, 2.5 mM MgCl2 and 0.3% CHAPS). After 20 min of incubation on ice and 10 min of centrifugation at 4°C, 500 μg of Lysates were pre-cleared with 30 μl Protein A/G Agarose beads (Invitrogen) for 2h and supernatants were collected. IPs were performed by mixing supernatants with 3 μg of E2F1 (Santa Cruz) or HDAC1 (Santa Cruz) antibodies or IgG (Abcam), together with 30 μl of Protein A/G Agarose beads, for overnight at 4°C. After 3 washes of PBS buffer, the immuno-complexes were eluted by 10 min boiling in 2x SDS loading buffer.

The following antibodies, reagents, and drugs were used: DMEM/F12, RPMI 1640, DMEM/High glucose medium and trypsin (Hyclone, Logan, UT, USA); Fetal Bovine Serum (FBS, Gibco, Carlsbad, CA, USA); Src inhibitor KX2-391 (Selleckchem, Houston, TX, USA); transwell inserts (Corning Inc., Corning, NY, USA); EGF (Cat No. 236-EG, R&D, USA); Matrigel (BD Biosciences, San Jose, CA, USA); Protein A/G agarose beads (Invitrogen, Carlsbad, CA, USA); Lipofectamine RNAiMax and Lipofectamine 2000 (Invitrogen, Carlsbad, CA, USA); antibodies against Rack1 (sc-17754), Anxa2 (sc-28385), p-Anxa2 (sc-135753), GFP (sc-9996, Santa Cruz Biotechnology, Santa Cruz, CA, USA); antibodies against Src (# 2123) and p-Src (# 6943, Cell Signaling Technology, Beverly, MA, USA); antibodies against Flag (F1804) and β-actin (A1978, Sigma, St. Louis, MO, USA); and Rack1, Anxa2, and Src small interfering RNAs (siRNAs, Invitrogen, Carlsbad, CA, USA, detailed information is listed in Table 1).Table 1

siRNA sequences used in this study

Name	Sequence
siRack1-1#	Upper: UAUCUCGAGAUCCAGAGACAAUCUG
	Lower: CAGAUUGUCUCUGGAUCUCGAGAUA
siRack1-2#	Upper: ACGAUGAUAGGGUUGCUGCUGUUGG
	Lower: CCAACAGCAGCAACCCUAUCAUCGU
siSrc-1#	Upper: CAGCAGCUGGUGGCCUACUACUCCA
	Lower: UGGAGUAGUAGGCCACCAGCUGCUG
siSrc-2#	Upper: GAGCCCAAGCUGUUCGGAGGCUUCA
	Lower: UGAAGCCUCCGAACAGCUUGGGCUC
siAnxa2-1#	Upper: UACAGCAGCGCUUUCUGGUAGUCGC
	Lower: GCGACUACCAGAAAGCGCUGCUGUA

For immunoprecipitation, 60 μL of 50% protein A/G Agarose beads (Invitrogen) were incubated with control or specific antibodies (2–4 μg) for 8 h at 4 °C with constant rotating, then centrifuged at 500 × g for 5 min at 4 °C. Whole cell lysates were re-suspended by prepared cold lysis buffer (50 mM Tris-HCl, pH = 7.4, 150 mM NaCl, 5 mM EDTA, 0.5% NP-40 supplemented with fresh protease inhibitors cocktail) for 1 h at 4 °C, centrifuged at 13,400 × g for 15 min at 4 °C. 500 μg of protein was then added and the incubation was continued for overnight at 4 °C. Beads were then washed five times using the lysis buffer, eluted in 2 × SDS loading buffer and boiling for 10 min. The boiled sample complexes were subjected to SDS-PAGE followed by immunoblotting with appropriate antibodies.

Twenty CNC explants from stage 18 embryos were incubated in Ca²⁺- and Mg²⁺-free MBS for 1 h at 12°C, and the dissociated cells were labeled with 500 μl of a 2 mg/ml sulfo-NHS-LC-biotin solution (Pierce, 21335) for 20 min at 15°C. After three washes with 100 mM of a glycine solution, the cells were lysed in MBS, 1% Triton X-100, 5 mM EDTA and proteinase inhibitors. Following centrifugation at 12,000 g for 30 min at 4°C, immunoprecipitation was performed overnight with 10 μg of anti-Intα5 antibody (P8D4, a kind gift from Dominique Alfandari, University of Massachusetts, MA) loaded on Protein A/G agarose beads (Invitrogen, 20423). The beads were washed three times in Tris-buffered saline (TBS) that contained 1% Triton X-100 and once in TBS, treated with lyases and ultimately eluted in 2× non-reducing Laemmli Buffer. Proteins were separated by 8% SDS-PAGE, transferred onto nitrocellulose and detected with horseradish peroxide (HRP)-conjugated streptavidin (Invitrogen, 1:75,000).

After treatment, cells were harvested and lysed with IP lysis buffer (Meilunbio, China) containing a protease inhibitor cocktail on ice for 30 min, followed by centrifugation for 5 min at 12,000 rpm at 4°C. The antibodies against the target protein were incubated with Protein A/G-Agarose Beads (Invitrogen, USA) for 4 h at 4 °C, mixed with the lysate, and incubated at 4 °C for 16 h. After four washes with PBS, the Co-IP products were collected and analyzed by western blotting.

For co-immunoprecipitation analysis, cells lysates were incubated with 5ug antibody on a rotator overnight at 4^oC. The protein-antibody-protein A/G agarose complexes were prepared by adding protein A/G agarose beads (Invitrogen) for an hour at 4^oC. After extensive washing with Radio-Immunoprecipitation Assay (RIPA) lysis buffer, the immunoprecipitated complexes were resuspended in reducing sample buffer and boiled for 10 minutes. After centrifugation to pellet the agarose beads, supernatants were subjected to SDS-PAGE and immunoblotting.