Ppack packaging plasmid mix

One day before transfection, 293TN cells were seeded into 10 cm dishes. Two micrograms of each pSIH1-shRNA-RPS5 vector or pSIH-NC or pSIH-shRNA-RPS5 and 10 μg pPACK Packaging Plasmid Mix (System Biosciences) were co-transfected using Lipofectamine 2000 (Invitrogen) in accordance with the manufacturer’s protocol. The medium was replaced with DMEM plus 1% FBS. Forty-eight hours later, the supernatant was collected and then cleared by centrifugation at 5000 × g at 4 °C for 5 min, and passed through a 0.45 μM PVDF membrane (Millipore, Shanghai, China). The titer of virus was determined by gradient dilution. The packaged lentiviruses were named as Lv-shRNA-RPS5, Lv-NC and Lv-RPS5.

The 293T human embryonic kidney cell line, and PANC-1 and Capan-2 pancreatic cancer cell lines were purchased from the American Type Culture Collection and were previously tested for mycoplasma contamination. Cells were routinely cultured in Dulbecco’s Modified Eagle Medium (Macgene, China) with 10% fetal bovine serum (Hyclone, USA). The FLAG-tagged LDHB eukaryotic expression vector was generated by inserting PCR-amplified fragments of the LDHB gene into pcDNA3 (Invitrogen, USA). Lentiviral shRNA vectors of LDHA and LDHB were constructed by cloning short hairpin RNA fragments into pSIH-H1-Puro (System Biosciences, USA). Target sequences are as follows, LDHA shRNA: 5’- ATCCAGTGGATATCTTGACCTACG -3’; LDHB shRNA: 5’- GGATATACCAACTGGGCTATT -3’. Lentiviruses were produced by co-transfection of HEK293T cells with recombinant lentivirus vectors and pPACK Packaging Plasmid Mix (System Biosciences, USA) using PEI reagent (Polyscience, USA). Lentiviruses were used to infect target cells in accordance with the manufacturers’ instructions. Myc-TERT, Flag-TERT, and GST-TERT plasmids were described previously (15 (link)). Sodium pyruvate, Sodium lactate, Methyl pyruvate and IPTG were products from Sigma (USA). 2-DG and AT-101 were purchased from Selleck (USA).

HEK293T cells were seeded onto 10-cm dish and cotransfected with lentivirus transfer vectors (pCDH-CMV vector carrying AXL, AXL-ICD, AXL-K567R, Flag-AXL) and pPACK Packaging Plasmid Mix (Systems Biosciences) according to manufacturer instructions. Culture medium was concentrated with PEG-it precipitation solution (Systems Biosciences). Pseudoviral particles were suspended in prechilled PBS, portioned into aliquots, and stored at −80°C. For infection of HEK293T cells, MEFs, and HCC827 cells, concentrated virus, together with polybrene (8 μg/ml; Sigma-Aldrich), was used. After 48 h transduction, clones that stably overexpressed AXL were screened with 2.5 μg/ml puromycin for 1 wk. Protein expression levels were evaluated by Western blot.

Pseudotype lentiviruses were produced in 293T cells by cotransfecting lentiviral pCDH-TDP2 expressing construct and pPACK Packaging Plasmid Mix (System Biosciences), following the manufacturer's instructions. Pseudoviral particles were harvested 48 hours after transfection and concentrated using PEG-it Virus Precipitation Solution.