Rotor gene 6000 software v1

The parasite burden in the brain and lungs of infected mice was assessed as
previously described60 (link) by a quantitative real-time PCR (qPCR)
analysis of the parasite DNA performed in a Corbett rotor gene 6000 system
(Corbett life science, Sydney, Australia). Product amplification was performed
with 500–1000 ng of template DNA using KAPPA Probe fast
universal qPCR kit (Kappa biosystems, Wilmington, MA, USA) for the amplification
of a 103 bp sequence of the Nc5 region of N. caninum genome
using the primers NcA 5′ GCTACCAACTCCCTCGGTT 3′ and NcS
5′ GTTGCTCTGCTGACGTGTCG 3′ both at a final concentration
of 0.2 μM and the florescent probe
FAM-CCCGTTCACACACTATAGTCACAAACAAAA-BBQ (all designed and obtained from
TIB-Molbiol, Berlin, Germany). The DNA samples were amplified using the
following program: 95 °C for 3 min,
95 °C for 5 sec,
60 °C for 20 sec with fluorescence
acquisition, the second and third step were repeated 45 times. Length of the
amplified DNA was confirmed in a 3% agarose gel stained with ethidium bromide.
In all runs parasite burden was determined by interpolation of a standard curve
performed with DNA isolated from N. caninum tachyzoites, ranging from 2
to 2 × 10⁵ parasites,
included in each run. Data were analyzed in the Rotor gene 6000 software v1.7
(Corbett life science) and expressed as log₁₀ parasites per mg of
total DNA.

DNA was extracted from the brain, liver and lungs of infected mice, as previously described [38 (link)]. Parasite burden was assessed by quantitative real-time PCR (qPCR) using the primers NcA 5′-GCTACCAACTCCCTCGGTT-3′ and NcS 5′-GTTGCTCTGCTGACGTGTCG-3′, the TaqMan fluorescent probe FAM-CCCGTTCACACACTATAGTCACAAACAAAA-BBQ (all from TIB Molbiol GmbH, Berlin, Germany) and NZY qPCR Probe Master Mix (Nzytech, Lisbon, Portugal). Samples were run in a Corbett rotor gene 6000 system (Corbett Life Science, Sydney, NSW, Australia), according to previously described methods [16 (link)]. In all runs, parasite burden was determined by interpolation of a standard curve performed with DNA isolated from N. caninum tachyzoites, ranging from 10 to 1 × 10⁻⁴ ng of parasitic DNA (2 to 2 × 10⁵ parasites), included in each run. Data were analyzed in the Rotor gene 6000 software v1.7 (Corbett Life Science) and expressed as log10 parasites per mg of DNA.