Quantstudio dx real time pcr instrument

The amount of E30 remaining on the surface of RD cells after 6C5/4B10 treatment was quantitated by real-time RT-PCR. Briefly, E30 was mixed with various concentrations of 6C5 before and after the virus attachment to cells with a MOI of 1 at 4 °C. Then cells were washed three times and their total RNA was extracted by RNeasy mini kit (Qiagen, Hilden, Germany) and subjected to qPCR using SuperScrip III Platinum SYBR Green One-Step qRT-PCR Kit (Invitrogen, Carlsbad, USA) on the QuantStudio Dx Real-Time PCR Instrument (Applied Biosystems, Foster City, USA). The 20 μL reaction mixture contained 0.2 μL SuperScript III RT/Platinum Taq Mix, 5 μL 2X SYBR Green Reaction Mix, 0.2 μL each of 10 μM forward (5′-AAC AGC GTT GCC CGC GTC TA-3′) and reverse primers (5′-ACC CTG TAG TTC CCT ACA TA -3′), 2 μL total RNA, and 2.4 μL RNase-free H2O. The thermal profile for qPCR was as follows—42 °C for 5 min for reverse transcription, 95 °C for 5 min for reverse transcription inactivation; this was followed by 40 cycles of denaturation at 95 °C for 15 s, annealing and extension at 60 °C for 30 s. Endogenous housekeeping gene β-Actin (forward 5′-GCC CTG AGG CAC TCT TCC A-3′, reverse 5′-CGG ATG TCC ACG TCA CAC TT-3′) was used as an internal control to normalize samples. The analysis of relative levels of E30 RNA in different samples was performed by employing the comparative 2^−ΔΔCt method^{61 (link)}.

Total RNA was isolated from tissues or cultured cells using Trizol reagent (Invitrogen, Carlsbad, CA, USA) following the manufacturer's protocol and RNA was reverse transcribed into cDNA using the RevertAid H Minus First Strand cDNA Synthesis Kit (K1632, Thermo Fisher Scientific, Waltham, MA, USA). RT-PCR was performed in triplicate using a SYBR green mix (Applied Biosystems, Foster City, CA, USA) and a QuantStudio Dx Real-Time PCR Instrument (Applied Biosystems) under the following conditions: 10 min at 95°C, followed by 40 cycles of 95°C for 15 s and 60°C for 1 min. GAPDH was used as an internal reference for normalization. The primer sequences (Sangon, Shanghai, China) were as follows: PSMD14, F: 5'-GTCAGGAACAGGTGTCAGTGT-3', R: 5'-AACCAACAACCATCTCCGGC-3'; GAPDH, F: 5'-CAGGAGGCATTGCTGATGAT-3', R: 5'-GAAGGCTGGGGCTCATTT-3'; P21, F: 5'-CCATGTGGACCTGTCACTGTCTT-3', R: 5'-CGGCCTCTTGGAGAAGATCAGCCG-3'; and PUMA, F: 5'-GGTCCTCAGCCCTCGCTCTC-3', R: 5'-CTTGTCTCCGCCGCTCGTAC-3'.

Total RNA was isolated from 15 wild-type zebrafish embryos of different development stages using TRIzol reagent (TaKaRa, Japan). cDNA was synthesized by using the RevertAid Fist Strand cDNA Synthesis kit (Thermo Fisher Scientific, United States). qRT-PCR was performed using SYBR Green (TaKaRa, Otsu, Japan) on a QuantStudio Dx Real-Time PCR Instrument with QuantStudio Dx Software (Applied Biosystems, Foster City, CA, United States). The 18s ribosomal RNA (18-s) gene was chosen as the reference gene (McCurley and Callard, 2008 (link)). The relative expression levels of each sample were calculated using the RQ formula (RQ = 2^–ΔΔCq) (Bustin et al., 2009 (link)); and these assays were carried out in three independent triplicates, with final calculations based on the means of triplicate wells. The sequences of primers are shown in Supplementary Table 1.

Total RNA was extracted from cultured cells or frozen adipose tissue using the Eastep Super Total RNA Extraction Kit (Promega (Beijing) Biotech Co., China). The absorbance ratio at 260/280 nm and the RNA concentration of each sample were detected using a NanoDrop ND2000 spectrophotometer (Thermo Scientific). Reverse transcription was performed using the PrimeScript Reverse Transcript Master Mix (TaKaRa, Japan). qPCR was performed using a QuantStudio Dx Real-Time PCR Instrument (Applied Biosystems). The comparative ΔΔCt method was used to evaluate the relative mRNA levels; 36B4 served as the reference gene (Supplementary Table 1).

TRIzol reagent (Invitrogen) was applied to extract total RNA of BC tissues and the cultured cells according to the manufacturer’s instructions. Then RNAs were reverse transcribed into cDNA by HiScript® II Q RT SuperMix for qPCR (+gDNA wiper) (Vazyme, Nanjing, China). qRT-PCR was performed using Hieff UNICON®qPCR SYBR Green MasterMix (Yeasen, China) in an QuantStudio™ Dx Real-Time PCR Instrument (Applied Biosystems, USA). The results were normalized to GAPDH. The primers for qRT-PCR were as follow: DPT (forward GGGGCCAGTATGGCGATTATG and reverse CGGTTCAAATTCACCCACCC); DNMT3a (forward ACGATTGCTAGACTGGGATAATG and reverse AGTAAGCAGGCCAGGTAGA); GAPDH (forward GGAGCGAGATCCCTCCAAAAT and reverse GGCTGTTGTCATACTTCTCATGG).