Human colon carcinoma HT29 and DLD1 cell lines were obtained from the American Type Culture Collection and cultured in RPMI-1640 medium containing 10% FBS. For stable cell line selection, human GRP78 cDNA was subcloned into the pLVX-AcGFP1-N1 Vector (Clontech). GRP78 shRNAs constructed in pLKO.1-Puro were purchased from Sigma (Mission shRNA). GRP78 overexpression/shRNA plasmid, psPAX2 and pMD2.G were co-transfected into 293T cells at 15:10:5 g. Media containing virus was collected and concentrated using 100 kDa ultrafiltration membranes (Millipore). DLD1 cells were infected with the viruses in the presence of polybrene (8 μg/ml) for 24 h, and then subjected to selection by 5 μg/ml puromycin. Hairpin sequences in these shRNA constructs are depicted as follows: Table 1 shRNA sequences used in this study: GRP78-1: 5’-CCGGAGATTCAGCAACTGGTTAAAGCT CGAGCTTTAACCAGTTGCTGAATCTTTTTTG-3’; GRP78-2: 5’-CCGGGAGCGCATTGATACTAGAAATCTCGAGATTTCTAGTA TCAATGCGCTCTTTTTG-3’; Control: 5’-CCGGCCTAAGGTTA AGTCGCCCTCGCTCGAGCGAGGGCGACTTAACCTTAGGTT TTTG-3’.
100 kda ultrafiltration membranes
Manufactured by Merck Group
Sourced in Germany
The 100 kDa ultrafiltration membranes are laboratory equipment used for the separation and concentration of macromolecules based on their molecular weight. These membranes have a pore size that allows the passage of molecules smaller than 100 kDa, while retaining larger molecules. The primary function of these membranes is to facilitate the purification and concentration of proteins, peptides, and other high-molecular-weight biomolecules from complex mixtures.
Automatically generated - may contain errors
Lab products found in correlation
Plvx acgfp1 n1 vector, by Takara Bio (2 mentions)
Mission shrna, by Merck Group (2 mentions)
Plko 1 puro, by Merck Group (2 mentions)
Turbofect, by Thermo Fisher Scientific (2 mentions)
Lipofectamine 3000, by Thermo Fisher Scientific (2 mentions)
Dld 1, by American Type Culture Collection (1 mentions)
Detoxi gel endotoxin removing column, by Thermo Fisher Scientific (1 mentions)
5 protocols using 100 kda ultrafiltration membranes
1
Stable GRP78 Overexpression and Knockdown
2
Isolation and Purification of Extracellular Vesicles
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Fn was cultured under anaerobic conditions (99% N2 at 37°C) until optical density (600 nm) reached 1.5 as described previously.18 (link) The isolation of EVs was performed as follows. Briefly, after pelleting of bacterial cultures (10000 g for 20 min), the obtained supernatants were filtred (0.22 μm) to remove parental bacterial debris and other contaminants. The supernatant was further concentrated to 1/8 of its initial volume using 100 kDa ultrafiltration membranes (Millipore, Germany), ultracentrifuged at 4°C and 60000 g for 30 min, and washed with PBS twice to obtain the crude EVs. The purified EVs were filtered (0.22 μm) again before ultracentrifugation in a 45 Ti rotor at 150000 g at 4°C for 2 h using a sucrose density gradient, followed by endotoxin removal with a Detoxi-Gel Endotoxin Removing Column (Thermo Scientific, USA). The final pellets were resuspended in PBS and stored at −80°C.
3
Efficient Transient Transfection and Lentiviral Transduction
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For transient transfection, plasmids were introduced into 293T cells using the transfection reagent TurboFect (Thermo Scientific). For lentivirus infection, the overexpression/shRNA plasmids PsPax2 and pMD2.G were co-transfected into 293T cells using the calcium phosphate method at 15: 12.5: 3.75 g (for a 10-cm dish). The virus-containing medium was collected at 48 h after transfection and was then concentrated using 100-kDa ultrafiltration membranes (Millipore). Cells were infected with the viruses in the presence of polybrene (8 μg/ml) for 48 h and then subjected to selection with 5 μg/ml puromycin for 72 hours.
4
Lentiviral-Mediated GRP78 Manipulation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Human GRP78 cDNA was subcloned into the lentiviral expressing vector pLVX-AcGFP1-N1 Vector (Clontech). GRP78 shRNAs constructed in pLKO.1-Puro were purchased from Sigma (Mission shRNA). GRP78 overexpression/shRNA plasmid, pCMVdR8.91 and pCMV-VSV-G were co-transfected into 293T cells using the Calcium Phosphate method at 15:10:5 g (for a 10-cm dish). Media containing virus was collected 48 h after transfection and then concentrated using 100 kDa ultrafiltration membranes (Millipore). DLD1 cells were infected with the viruses in the presence of polybrene (8 μg/ml) for 48 h, and then subjected to selection by 5 μg/ml puromycin for 72 hours. Hairpin sequences in these shRNA constructs are depicted in Supplementary Table 3 .
5
GRP78 Overexpression and Knockdown in Colorectal Cancer
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Human GRP78 cDNA, different truncated mutants, and T453D mutant of GRP78 were constructed into the pLVX-AcGFP1-N1 vector. Human GRP78 shRNAs were constructed in pLKO.1-Puro vector. pLVX-AcGFP1-N1-GRP78 or pLKO.1-Puro-shGRP78 plasmid was co-transfected into 293 T cells with psPAX2, and pMD2.G using the Calcium Phosphate method at 15:10:5 g (for a 10-cm dish). After transfection 48 h, supernatant media containing the virus was collected and concentrated with 100 kDa ultrafiltration membranes (Millipore). Concentrated viruses were used to infect DLD1 and SW480 cells in the presence of polybrene (8 μg/mL) for 48 h. To get stable cell lines, the virus-infected cell needs to be further selected with 5 μg/mL puromycin for 72 h. The Human ATF-6 and MRP1 siRNA was designed and synthesized by GenePharma (Shanghai, CHN), and transfected in cells by Lipofectamine 3000 (Thermo Fisher Scientific). The sequences of shRNA and siRNA are listed in Supplemental Table 3 .
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!