Custom RNA FISH Probes were designed against mouse CCL2 mRNA (NM_011333) utilizing the Stellaris® FISH Probe Designer (Biosearch Technologies, Inc., Petaluma, CA) available online at www.biosearchtech.com/stellarisdesigner . 10μm sections of prostate from naive and EAP treated mice were hybridized with the Stellaris FISH Probe set pooled by 14 singly labeled mouse CCL2 probes (tgagccaacacgtggatgct, tggggcgttaactgcatctg, tggtgaatgagtagcagcag, ctactcattgggatcatctt, tgctggtgatcctc ttgtag, actacagcttctttgggaca, tctcttgagcttggtgacaa, ttcttggggtcagcacagac, gatctcatttggttccgatc, aaggtgctg aagaccttagg, tttacgggtcaacttcacat, tagtggatgcattagcttca, ctcctacagaagtgcttgag, tagttcactgtcacactggt) with TAMRA dye (Biosearch Technologies, Inc.). Following the manufacturer’s instructions slides were thawed to room temperature and immersed in 3.7% formaldehyde in 1 X PBS for 10min. Slides were washed twice with 1X PBS for 2-5 minutes and permeabilized by incubation in 70% ethanol for 1 hour at room temperature. Slides were washed in wash buffer A (Biosearch Technologies Cat# SMF-WA1-60), followed by probes hybridization overnight at 37°C. Samples were counterstained with DAPI, rinsed in wash buffer B (Biosearch Technologies Cat# SMF-WB1-20), and coverslipped with Vectashield® Mounting Medium (Vector Laboratories Cat #H-1000).
Tamra dye
Manufactured by Biosearch Technologies
TAMRA dye is a fluorescent dye used in various laboratory applications. It exhibits excitation and emission wavelengths that make it suitable for fluorescence-based detection and analysis techniques. The core function of TAMRA dye is to provide a fluorescent label for biomolecules, enabling their visualization and quantification.
Automatically generated - may contain errors
Lab products found in correlation
Stellaris fish probe designer, by Biosearch Technologies (2 mentions)
Smf wb1 20, by Vector Laboratories (1 mentions)
Smf wa1 60, by Biosearch Technologies (1 mentions)
Vectashield mounting medium, by Vector Laboratories (1 mentions)
C10600 10b orca r2, by Hamamatsu Photonics (1 mentions)
Axio observer a1 inverted microscope, by Zeiss (1 mentions)
2 protocols using tamra dye
1
Quantitative RNA FISH for Murine CCL2
2
Single-Molecule FISH for daf-21 Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
smFISH probes were designed against daf-21 sequences utilizing the Stellaris FISH Probe Designer (Biosearch Technologies, Inc; (www.biosearchtech/com/stellarisdesigner ). Probe sets of 44 probes of 22 nucleotides each labeled with TAMRA dye (Biosearch Technologies, Inc.) were used. At least 10–20 1d and 4d old adult animals per strain were fixed using 4% paraformaldehyde and resuspended in 70% ethanol at 4°C for approximately 24 hours. Samples were then hybridized with the daf-21 Stellaris FISH Probe set following the manufacturer’s instructions (www.biosearchtech.com/stellarisprotocols ). For quantification of puncta, images were acquired on an Axio Observer A1 inverted microscope (Zeiss) using a 63X oil objective and a digital CCD camera (Orca-R2 C10600-10B, Hamamatsu). All samples were imaged under identical settings. Mean pixel intensities in the regions containing ASH/ASI neuronal cell bodies were measured using ImageJ (NIH).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!