Hiperfect transfection kit

SiRNA-HIF1A-AS2 and siRNA-Control were designed and purchased from GenePharma, China. Sequence of siRNA-HIF1A-AS2 was: 5′-CAGGAAACUUAAGCUUACATT-3′ and 5′-UGUAAGCUUAAGUUUCCUGTT-3′. Sequence of siRNA-Control was: 5′-UUCUCCGAACGUGUCACGUTT-3′ and 5′-ACGUGACACGUUCGGAGAATT-3′. SiRNAs and HiperFect transfection reagent were diluted in a serum-free medium and mixed (30 min, RT) in an equal-ratio to form a polyplex, according to the manufacturer's instructions (HiperFect Transfection Kit; QIAGEN). Polyplex mixture was then incubated 6 h with HASMCs in a humidified incubator containing 95% air and 5% CO₂ at 37°C. After transfection, polyplex mixture was replaced with fresh SMCM containing 10 ng/mL PDGF-BB (R&D Systems).

Silencing of NCX3 in MO3.13 cells was performed by using the HiPerFect Transfection Kit (Qiagen, Milan, Italy), by using the following FlexiTube siRNAs for NCX3, Hs_Slc8A3(#8) 5′‐CACCACGCTCTTGCTTCCTAA‐3′, and a validated irrelevant AllStars siRNA as a negative control (siCtl), as previously described (Boscia et al, 2012). Cells were incubated with Opti‐MEM (Invitrogen) supplemented with the RNAiFect Transfection Reagent (Qiagen) and 20 nM of the siRNA duplex for 6 h. Cells were incubated in OPC medium for 48 h before microfluorimetric [Ca²⁺]_i measurements.

siRNA transfection of primary CLL cells was performed using a HiPerfect transfection kit (Qiagen, Hilden, Germany), according to the manufacturer’s guidelines. Briefly, 1×10⁶ CLL cells were seeded in 200 μl IMDM/10%FBS and transfected with 60nM siRNA (final concentration in 600 μl) and 5 μl HiPerfect transfection reagent in 100 μl IMDM. After 6 hrs incubation, 300 μl of fresh IMDM/10%FCS containing 45 μg/ml gentamicin were added. Knockdown efficiency was assessed by western blotting after 72 hrs. Pre-designed, chemically-modified, siRNA oligoribonucleotides (Stealth™) targeting ID2 or ID3, as well as a negative control (Stealth™ medium GC Duplex) were purchased from Invitrogen (Carlsbad, CA, USA). The sequences of the ID siRNAs were as follows:

ID2: 5’- ACGTCATCGACTACATCTTGGACCT-3’;

ID3: 5’- GGCACTCAGCTTAGCCAGGTGGAAA-3’

Gene knockdown was carried out using the HiPerFect Transfection kit (Qiagen, Germany). THP-1 cells were transfected with 5 nM siRNA against ABI3 following the protocol of manufacturer, and cells transfected with irrelevant non-targeting siRNA, or were treated with sham transfection were used as negative control. The cells were cultured for another 24 h after transfection, and gene knockdown efficiency was measured by qRT-PCR and western blot.

The transfections of draining lymph node cells were performed as described earlier (29 (link), 30 (link)). In brief, cells isolated from draining LNs from mBSA-immunized mice were either transfected with scrambled miRNAs (Mock) or with mature miR-132-3p mimic (5′UAACAGUCUACAGCCA UGGUCG) or miR-132-3p (5′UAACAGUCUACAGCCAUGGUCG) inhibitor using the HiPerFect transfection kit (Qiagen) and following the company's protocol. The draining lymph node cells (4 × 10⁵ cells/well) were first cultured in complete RPMI medium in a 24-well plate, The following day, the cells were transfected with mock, mimic or inhibitor or both mimic and inhibitor. After transfection, the cells were incubated at 37°C for 24 h. Next, the transfected cells were collected and total RNAs including miRNAs were isolated using miRNeasy kit as described above (Qiagen). cDNAs were synthesized using total RNAs and miScript II RT kit (Qiagen) for target genes expression analysis and miRNAs validation.

RNA interference (RNAi) was performed as described earlier^{34 (link),35 (link)} with minor modifications. Specifically, silencing of NCX1 isoform was performed according to Qiagen manufacturer’s instruction using HiPerfect Transfection Kit (Qiagen) and FlexiTube small interference RNA (siRNA) for NCX1 (Qiagen, Hs_SLC8A1_9), and FlexiTube siRNA for NCX3 (Qiagen Hs_SLC8A3_7). The validated irrelevant Allstars siRNA (Qiagen) was used as a negative control. Target sequences of the FlexiTube NCX1 siRNA was Hs_SLC8A1_9 (5′-CAGGCCATCTTCTAAGACTGA-3′), and of the NCX3 siRNA sequences was Hs_ SLC8A3_7 (5′-ACCATTGGTCTCAAAGATTCA-3′). The transfection protocol was as follows: SH-SY5Y cells (200,000 cell/well) were differentiated with 10 µM RA in 6-well plates for 7 days. After differentiation protocol, SH-SY5Y cells were incubated 48 h with 2.3 ml of MEM7F-12 media containing 100 µl of MEM/F-12 (without FBS and antibiotics), 12 µl of HiPerfect Transfection Reagents, and 80 nM of siRNA oligonucleotide (each well). At 48 h after transfection, cells were subjected to specific treatments. The yield of RNA silencing was assessed by western blot analysis using specific antibody.