Nanodrop one microvolume uv spectrophotometer

RNA extracted from liver biopsies (as described above) was frozen at −80 °C, prior to further processing at the Department of Molecular and Medical Virology, Ruhr University Bochum, Germany. As determined using a NanoDrop One Microvolume UV Spectrophotometer (ThermoFisher), 50 ng of total RNA per reaction were subjected to one-step SYBR Green based qPCR using GoTaq^® qPCR Master Mix as described above. The LLOQ of this qPCR was 1 × 10³ viral copies/50 ng total RNA. All RNA samples from liver biopsies were analysed in duplicate, except for the biopsy from Vaccine Pony 3 on day +97, for which only a single analysis was done. The mean viral load of the two sample duplicates was determined for each biopsy.

RNA was isolated from A549 cells (3 × 10⁴ cells/well) and treated for 48 h using RNA easy mini Kit (Qiagen, USA) then the concentration and purity of total extracted RNA were determined using NanoDrop one micro-volume UV spectrophotometer (Thermos Fisher Scientific, USA). RNA of each treatment was converted to first-strand cDNA according to manufacturer instructions using Revert Aid First Strand cDNA Synthesis Kit (Thermo Scientific, USA). Specific primer sequences are listed in Table 1. Expression levels of β-Catenin, c-Myc, Cyclin D1, and MMP7 genes were normalized concerning β-actin transcript using Maxima SYBR Green qPCR Master Mix (2X) (Thermo Scientific, USA) and calculated by 2^−ΔΔCT method^{59 (link)}. The reaction conditions were as follows: 95 °C for 10 min, 95 °C for 15 s, 60 °C for 30 s and 72 °C for 30 s with a total of 40 cycles of amplification. DNA Technology Detecting Thermocycler DT Lite 4S1 was used for gene expression quantitation.Table 1

Orders of the primers used in the RT-PCR investigation.

Gene	Primer forward (5'-3')	Primer reverse (5'-3')
β-actin	CCTTCCTGGGCATGGAGTCCT	GGAGCAATGATCTTGATCTTC
β-Catenin	TAGAAACAGCTCGTTGTACCGCTGGGACCT	GCACTGCCATTTTAGCTCCTTCTTGATGTAAT
c-Myc	AGAGAAGCTGGCCTCCTACC	CGTCGAGGAGAGCAGAGAAT
Cyclin D1	GCTGCGAAGTGGAAACCATC	CCTCCTTCTGCACACATTTGAA
MMP7	GTGGTCACCTACAGGATCGTA	CTGAAGTTTCTATTTCTTTCTTGA

Viral RNA from liver and fly samples was extracted using the QIAamp Viral RNA kit (Qiagen, Hilden, Germany) according to the manufacturer's instructions. The extracted RNA was quantified using a NanoDrop One Microvolume UV Spectrophotometer (Thermo Fisher Scientific, Waltham, USA). cDNA was synthesised using ~1 μg of RNA using random hexamer and gene‐specific primers using SuperScript™ IV Reverse Transcriptase (Thermo Fisher Scientific, Waltham, USA).