Pyromark gold q24 reagent kit

A DNA fragment of interest was PCR-amplified with a biotinylated primer as described [77 (link)]. After denaturation, the biotinylated single-stranded PCR amplicon was hybridized with the sequencing primer, specific for the analyzed position. The allelic dosage was quantified on PyroMark Q24 instrument, with PyroMark Gold Q24 Reagent Kit (Qiagen), according to the manufacturer's instructions.

Genomic DNA isolated from the OSCC cell lines and patient samples was purified using a DNA isolation kit (Zymo Research, Irvine, CA, USA) and treated with sodium bisulfite using an EZ DNA methylation kit (Zymo Research, Irvine, CA, USA). Subsequently, a polymerase chain reaction (PCR) was performed to amplify the PTK6 promoter region, using Taq DNA polymerase (Invitrogen, Waltham, MA, USA). The pyrosequencing of the PCR products was performed using a PyroMark Gold Q24 Reagent kit (Qiagen, Hilden, Germany) to analyze the methylation status of the PTK6 promoter. Primers and PCR conditions designed using PyroMark Assay Design 2.0 software were used to amplify specific CpG islands. Methylated CpG sites were detected using a PyroMark Q24 system. The PTK6 S1 sequence for detection was CCGGACGGACGAGGAGCTGAGCTTCCGCGCGGGGGACGTCTTCCACGTGGCC (+125~+171) and the pyrosequence-designed nucleotide sequence for analysis was TYGGAYGGAYGAGGAGTTGAGTTTTYGYGYGGGGGAYGTTTTTTAYGTGG. The PTK6 S2 sequence for detection was TACCTGGCCGAGAGGGAGACGGTGGAGTCGGAACCGTGCG (+266~+298) and the pyrosequence-designed nucleotide sequence for analysis was TATTTGGTYGAGAGGGAGAYGGTGGAGTYGGAATYGTGYGTGTTTTAGGT. The primer sequences used in PCR and pyrosequencing are shown in Supplementary Table S1.

DNA was isolated using TIANamp Genomic DNA Kit (Tiangen Biotech, Beijing, China). DNA bisulfite conversion was modified using EZ DNA CT conversion reagent (Zymo Research Corporation, Irvine, CA, USA) following the manufacturer’s protocol. The primers for Fyn bisulfite DNA PCR and sequencing were designed using Pyromark Assay Design 2.0 software (Biotage, Uppsala, Sweden) and listed in Additional file 1. Gene model of Fyn was presented as Additional file 1: Fig. S1.
Bisulfite DNA PCR was performed in a total volume of 25 μl using the TaKaRa EpiTaq HS system (TaKaRa, Dalian, China). Pyrosequencing was performed on a PyroMark Q24 MD system (Qiagen) using the PyroMark Gold Q24 reagent kit (Qiagen) with 10 pmol of sequencing primer. Data were analyzed using Pyro Q-CpG software (Qiagen).