Dna gel recovery kit

To determine the pathogenicity of the ToMMV-LN isolate, we first constructed the full-length infectious cDNA clone of ToMMV-LN. Therefore, a specific primer pair (ToMMV-ssF and ToMMV-ssR; Table S1) was designed for amplifying the full-length genome of ToMMV-LN. PCR was performed using PrimeSTAR^TM Max DNA Polymerase as aforementioned. PCR conditions were 1 min at 94 °C, followed by 33 cycles of 10 s at 98 °C, 15 s at 55 °C and 4 min 30 s at 72 °C, followed by a final cycle of 10 min at 72 °C. The products were recovered by using DNA gel recovery kit (Axygen, San Francisco, CA, USA). The purified PCR product of the full-length cDNA was introduced into the binary vector pCB301-2 × 35S-RZ-NOS [40 ] linearized by two restriction Stu I and Sma I (New England Biolabs, Beijing, China) to produce pToMMV using homologous recombination approach by ClonExpress^TM II One Step Cloning Kit (Vazyme Biotech, Nanjing, China) according to the manufacturer’s protocol. The ligated product was transfected into Top 10 (Warbio Biotech, Nanjing, China) competent cells and cultivated on Luria–Bertani (LB) plates with Kanamycin (50 mg/L) for 14 h at 37 °C condition. Subsequently, we performed colony PCR and restriction enzyme digestion, and the fragments of pToMMV clone were verified by General Biosystems Company (Anhui, China) sequencing.

PCR amplification was performed using bacterial primer 338F_806R (338F: 5′–ACTCCTACGGGAGGCAGCAG–3′ 806R: 5′–GGACTACHVGGGTWTCTAAT–3′) and fungal primer ITS1F_ITS2R (ITS1F: 5′–CTTGGTCATTTAGAGGAAGTAA–3′ ITS2R: 5′–GCTGCGTTCTTCATCGATGC–3′). Following Liu Z. et al. (2020) (link), the volume of the PCR system was 20 μL, containing 4 μL 5 × FastPfu Buffer; 2 μL 2.5 mM dNTPs; 0.8 μL of each primer for a final concentration of 5 μM; 0.4 μL FastPfu Polymerase; 0.2 μL BSA; 10 ng template DNA; and ddH₂O to complete 20 μL. The PCR parameters were as follows: (1) 3 min, 95°C denaturation. (2) 30 s, 95°C; 30 s, 55°C annealing; 45 s, 72°C elongation, 35 cycles. (3) 10 min, 72°C extension. The PCR products were detected by 2% agarose gel electrophoresis and recovered using a DNA gel recovery kit (Axygen Biosciences, Union City, CA, United States). The PCR products were quantified by the Quanti Fluor™–ST Blue Fluorescence Quantification System (Promega, Madison, WI, United States). Samples were sent to Majorbio Biopharmaceutical Technology Co., Ltd. (Shanghai, China) for sequencing using the Illumina MiSeq high-throughput sequencing platform (Illumina, San Diego, CA, United States). Each sample was analyzed in triplicate.