Verso cdna ki

Total RNA extraction was carried out using Trizol reagent (Invitrogen) according to the manufacturer’s instruction. Two microgram of total RNA was subjected to reverse Transcription (RT) using Verso cDNA Ki (Thermo Scientific). Real-time quantitative PCR was conducted by Platinum SYBR Green qPCR SuperMix UDG with ROX kit (Invitrogen) in 20 μl and ABI 7300 real-time PCR thermal cycle instrument (ABI, USA) according to the supplied protocol. The primers for MEK5 were: (F, CTTTAATGCCTCTCCAGCTTCT; R, CCATCATTGAACTGCACGAT). The relative expression levels were normalized to expression of endogenous GAPDH. (Primers: F, GGGAAACTGTGGCGTGAT; R, GAGTGGGTGTCGCTGTTGA).

Total RNA extraction was performed using Trizol reagent (Invitrogen) according to the manufacturer’s instruction. RNA concentration was measured by Nano Drop 1000 (Thermo Fisher Scientific). One microgram of total RNA extracted from the cells was subjected to reverse Transcription (RT). Verso cDNA Ki (Thermo Scientific) was used for cDNA synthesis. Real-time RT-PCR was used to quantify the expression level of STMN-1 gene in Esophageal adenocarcinoma cell line using ABI 7300 real-time PCR thermal cycle instrument (ABI, USA), according to the supplied protocol. Amplification conditions were as follows: Reverse-transcription reaction: 42°C, 30 minutes per cycle. PCR cycling conditions were as follows: Enzyme activation 95°C 15 minutes per cycle, denaturation 95°C at 15 seconds per 40 cycles and Annealing/Extension at 60°C for 60 seconds.
A Real-time PCR reaction was performed using the Solaris qPCR Gene Expression Master Mix with LOW ROX premixed and 1 μL of total cDNA in each well, Stathmin specific primers were as follows:
(F, AGAATACACTGCCTGTCGCTTG; R, AGGCACGCTTCTCCAGTT). The relative expression levels were normalized to expression of endogenous Beta-Actin. (Primers: F, TGGAGAAAATCTGGCACCAC; R, GGTCTCAAACATGATCTGG).