Cd18 hpaf

Human PC lines SW1990 (CVCL_0221), COLO357 (CVCL_1723), T3M4 (CVCL_4056), CD18/HPAF (CVCL_0313), and MIA PaCa-2 (CVCL_0428) were obtained from the ATCC. Cell lines were routinely authenticated using short tandem repeat profiling. SW1990, T3M4, COLO357, and MIA PaCa-2 cells were cultured in DMEM media with 10% FBS. NSCLC lines SW1573 (CVCL_1720), H2122 (CVCL_1531), and A549 (CVCL_W218) were maintained in 10% RPMI.

Human pancreatic cancer cell lines AsPC-1, CD18/HPAF and Capan-1 were obtained from the American Type Culture Collection (Manassas, VA) and maintained in Dulbecco's Modified Eagle's medium containing 10% fetal bovine serum. HPNE cells are primary human pancreatic ductal cells immortalized using hTERT, the catalytic subunit of human telomerase [57 (link)]. HPNE cells were maintained in Medium D medium, which contains 3 parts of high glucose DMEM (Life Technologies, Carlsbad, CA), 1 part of M3F (INCELL, San Antonio, TX), 5% fetal bovine serum and 100 ng/ml recombinant EGF (Life Technologies) [57 (link)].
Rac1 specific inhibitor NSC23766 [21 (link)] was obtained from Tocris Biosciences (Ellisville, MO). Experimental compounds were purchased from ChemBridge (San Diego, CA). All compounds were dissolved in DMSO.

CD18/HPAF and Capan-1 cells were procured from American Type Culture Collection [ATCC] (Manassas, VA, USA) and cell lines were propagated in a humidified atmosphere containing 5% CO₂ at 37°C and cultured in Dulbecco's modified Eagle's medium supplemented with 10% fetal calf serum and antibiotics. HER2 was stably knockdown using HER2 sh-RNA (GAAACCTGGAACTCACCTAC) [which target N-terminal portion of HER2], (sh-HER2seq2-GCAGAGGATGGAACACAGCGGTGTGAGAA) [which target C-terminal of HER2] and (sh-HER2seq3-TGTTGGATGATTGACTCTGAATGTCGGCC) [which target C-terminal region of HER2] construct (pSUPER-Retro-sh-HER2) in HER2 expressing CD18/HPAF and Capan-1 cells by stable transfection method. Scramble control (sh-control) and pSUPER-Retro-sh-HER2 has been transfected into packaging cell Phoenix using Lipofectamine 2000 (Invitrogen, Carlsbad, CA, USA). After 48 h post transfection, the viral particles were collected and used to infect CD18/HPAF and Capan-1 cells. Pooled population of HER2 knockdown cells were obtained using antibiotic selection (Puromycin 4 μg/ml), and were further expanded to confluent levels to obtain stably transfected cells. The dual PI3K and mTOR inhibitor (NVP-BEZ235, LC laboratories, MA, USA) was dissolved in dimethyl sulfoxide (DMSO) and prepared as 10mM stock and stored at −20°C as per the manufacturer's recommendation.

The human pancreatic cancer cell lines Capan-1, CD18/HPAF, Mia Paca-2, and T3M4 were obtained from American Type Culture Collection and cultured in DMEM with 7% heat-inactivated fetal bovine serum. Cells were carried out in a 5% CO₂ incubator at 37 °C. Gemcitabine HCl was obtained from LC Laboratories (Woburn, MA, USA). Abraxane was a kind gift from Celgene (Summit, NJ, USA). Tin protoporphyrin IX dicholoride, zinc protoporphyrin, and ferrostatin-1 were obtained from Santa Cruz Biotechnology (Dallas, TX, USA). Erastin (a positive control for Ferroptosis) was purchased from Cayman Chemical (Ann Arbor MI).
The gemcitabine-resistant pancreatic cancer cell lines (T3M4, and MiaPaca-2) were a kind gift from the laboratory of Dr. Pankaj Singh, as described before [27 (link)].