Pexp1

A gene encoding C. difficile 630 open reading frame CD2718 (srtB) omitting amino acids 1–32 was synthesised by Entelechon GmBH and cloned into plasmid vector pEXP1 (Invitrogen) to generate pEXP-srtB such that the protein was fused with a C-terminal hexahistidine tag. Plasmid pEXP1-srtB-C226A, encoding a mutant of SrtB with a cysteine to alanine substitution at position 226, was generated by site directed mutagenesis. Briefly, the entire plasmid was amplified by polymerase chain reaction (PCR) using HiFi polymerase (Roche diagnostics) using the oligonucleotide primers (SrtBC226AF - GTTACGCTGTCTACTGCTACTTACGAATTCG, SrtBC226AR - CGAATTCGTAAGTAGCAGTAGACAGCGTAAC) at an annealing temperature of 65°C. The codon substitution was confirmed by sequencing of the srtB gene. A gene encoding C. difficile 630 CD0386 was cloned into pTAC-MAT1 such that the protein was fused with an N-terminal hexahistidine tag. E. coli Bl21DE3 (Invitrogen) transformed with pEXP1 SrtB, pEXP1 SrtB C226A or pTAC-MAT1 CD0386 were grown to an optical density of 0.6 in Terrific Broth. IPTG was added to a final concentration of 1 mM and growth continued at 16°C for a further 16 hrs. Cells were harvested by centrifugation for 30 mins at 3,500 g and resuspended 10% w/v in 25 mM HEPES pH7.5, 500 mM NaCl, 10 mM Imidazole.