shRNA sequences were designed using BLOCK‐iT™ RNAi Designer and inserted into the hCMV promoter‐driven lentiviral miRZip vector (System Biosciences, Palo Alto, CA, USA) at the downstream of its GFP at BamH1 and EcoR1. The shRNA sequences for TXNIP are forward oligo: 5′‐ GATCCGGATCTGGTGGATGTCAATACTTCAAGAGAGTATTGACATCCACCAGATCCTTTTTG‐3′ and reverse oligo: 5′‐ AATTCAAAAAGGATCTGGTGGATGTCAATACTCTCTTGAAGTATTGACATCCACCAGATCCG −3′.
Mirzip vector
Manufactured by System Biosciences
Sourced in United States
The MiRZip vector is a plasmid-based construct designed for the expression and stable knockdown of microRNAs (miRNAs) in mammalian cells. It provides a tool for researchers to investigate the functional roles of specific miRNAs.
Automatically generated - may contain errors
4 protocols using mirzip vector
1
Lentiviral shRNA Knockdown of TXNIP
2
miR-572 Inhibition and Gene Silencing
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The miR-572 anti-sense (miRZip-572) plasmid used as miR-572 inhibitor, and the vector control (miRZip-Vector) were purchased from System Biosciences (San Francisco, CA) and used according to previous report [31 (link)]. For depletion of SOCS1-, and p21-siRNAs were synthesized and purified by RiboBio. Transfection of oligonucleotides and siRNAs were performed using the Lipofectamine 2000 reagent (Invitrogen), according to the manufacturer's instruction.
3
SNHG15 Knockdown via Lentiviral shRNA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Using BLOCK-iT™ RNAi Designer, shRNA sequences were designed targeting exon 4 of all SNHG15 isoforms. shRNA sequences were inserted into the hCMV promoter-driven lentiviral miRZip vector (System Biosciences, Palo Alto, CA, USA) downstream of GFP at BamH1 and EcoR1. The shRNA sequences for SNHG15 are as follows: forward oligo 1, 5’-GATCCGCAGTCTTTGTCCATGAAACTTTCAAGAGAAGTTTCATGGACAAAGACTGCTTTTTG −3’ and reverse oligo 1, 5’-AATTCAAAAAGCAGTCTTTGTCCATGAAACTTCTCTTGAAAGTTTCATGGACAAAGACTGCG −3’; forward oligo 2, GATCCGCACAAGAGTGCCTGCCATCCTTCAAGAGAGGATGGCAGGCACTCTTGTGCTTTTTG −3’ and reverse oligo 2, 5’- AATTCAAAAAGCACAAGAGTGCCTGCCATCCTCTCTTGAAGGATGGCAGGCACTCTTGTGCG −3’.
4
Stable S100A10 Knockdown in Breast Cancer
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The sequence of the full‐length coding region of the S100A10 mRNA (NM_002966.2 (GenBank)) was amplified by PCR and cloned into the pEIZ‐HIV‐ZsGreen lentivirus vector (Addgene: #18121).7 The shRNA sequences encoding for the S100A10 shRNA constructs (shS100A10) were cloned between the BamHI and EcoRI sites of the miRZIP vector (System Biosciences) and sequenced. The following target sequences were used: shS100A10‐1, CCATGATGTTTACATTTCACA; shS100A10‐5, GACCAGTGTAGAGATGGCAAA. A negative control was purchased from System Biosciences. Lentiviruses were produced as previously described.22 The culture supernatant containing lentivirus was collected and concentrated by LentiX concentrator (Clontech) and was resuspended in phosphate‐buffered saline. Breast cancer cells constitutively expressing S100A10 shRNA constructs were established by infecting cells with lentivirus constructs at a multiplicity of infection (MOI) of 5 (breast cancer cell line) or of 30 (breast cancer PDX cells). Infected cells were purified based on puromycin resistance (1 µg/mL) or their ZsGreen expression.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!