Liver homogenates were obtained with the FastPrep-24 Classic Instrument (MP Biomedicals, Irvine, CA, USA) from liver biopsies cryopreserved in Lysing Matrix D tubes (MP Biomedicals) filled with Tripure isolation reagent (Roche, Basel, Switzerland). Total RNA was extracted from liver homogenates using Tripure isolation reagent (Roche), according to the manufacturer’s instructions. Genomic DNA was digested by DNase I (Invitrogen). RNA was retro-transcribed using the high-capacity cDNA reverse transcription kit (Applied Biosystems, Waltham, CA, USA). RT-qPCR was carried out in duplicate using TaqMan universal MasterMix (Applied Biosystems) and pre-designed TaqMan probes obtained from Thermo Fisher Scientific or Integrated DNA Technologies (IDT; Coralville, IA, USA) on a StepOnePlus real-time PCR machine (Applied Biosystems) (Supplementary Table 3 ). Relative gene expression was determined with the ∆∆Ct method using TBP and PPIA as housekeeping genes for human experiments and Gapdh and B2m for rat experiments [53 (link)].
Tripure isolation reagent
Manufactured by Roche
Sourced in Germany, United States, Switzerland, Belgium, Italy, United Kingdom, France, Japan, Netherlands
TriPure Isolation Reagent is a single-solution reagent used for the isolation of high-quality total RNA, DNA, and proteins from a wide range of biological samples. It is based on the guanidinium thiocyanate-phenol-chloroform extraction method.
Automatically generated - may contain errors
Lab products found in correlation
Transcriptor first strand cdna synthesis kit, by Roche (54 mentions)
High capacity cdna reverse transcription kit, by Thermo Fisher Scientific (36 mentions)
Lightcycler 480, by Roche (24 mentions)
Nanodrop 1000, by Thermo Fisher Scientific (22 mentions)
Dnase 1, by Thermo Fisher Scientific (22 mentions)
Rneasy mini kit, by Qiagen (21 mentions)
Steponeplus real time pcr system, by Thermo Fisher Scientific (20 mentions)
Iscript cdna synthesis kit, by Bio-Rad (18 mentions)
Sybr green pcr master mix, by Thermo Fisher Scientific (18 mentions)
M mlv reverse transcriptase, by Promega (17 mentions)
Nanodrop, by Thermo Fisher Scientific (17 mentions)
Nanodrop 2000 spectrophotometer, by Thermo Fisher Scientific (17 mentions)
Iq sybr green supermix, by Bio-Rad (15 mentions)
Revertaid first strand cdna synthesis kit, by Thermo Fisher Scientific (15 mentions)
Primescript rt reagent kit, by Takara Bio (14 mentions)
Nanodrop 2000, by Thermo Fisher Scientific (14 mentions)
Nanodrop nd 1000 spectrophotometer, by Thermo Fisher Scientific (13 mentions)
Agilent 2100 bioanalyzer, by Agilent Technologies (12 mentions)
Quantitect reverse transcription kit, by Qiagen (12 mentions)
Nanodrop spectrophotometer, by Thermo Fisher Scientific (12 mentions)
712 protocols using tripure isolation reagent
1
Liver Gene Expression Analysis Protocol
2
Tissue RNA and Protein Extraction
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA and proteins were sequentially extracted from cells and human or mouse hippocampal tissue using Tripure Isolation Reagent (Roche, Basel, Switzerland; 100 mg tissue/1 ml Tripure Isolation Reagent) following the manufacturer's recommendations. RNA integrity (RIN) was determined by RNA Nano 6000 (Agilent, Santa Clara, CA). Although no differences between Braak groups were observed, the RIN was lower in human samples compared with transgenic models (RIN: 4.95 ± 1.4 or 8.5 ± 0.5 for human and mouse samples, respectively). RNA was quantified using NanoDrop 2000 spectrophotometer (Thermo Fisher, Waltham, MA). Proteins were quantified using Lowry's method.
3
Quantitative Gene Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
AR42J and B13 cells were cultured in 12-well plates and harvested 4 days post-transduction in 800 μl TriPure Isolation Reagent (Roche, Basel, Switzerland), and total RNA was isolated using an RNeasy Kit (Qiagen, Hilden, Germany). Total RNA was extracted from 100–200 isolated islets and 35 mg of exocrine fractions using 1 ml TriPure Isolation Reagent (Roche) and Rneasy Mini Kit (Qiagen). cDNA was synthesized from 1 μg total RNA by reverse transcription using a Transcriptor First Strand cDNA Synthesis Kit (Roche). Quantitative real-time PCR (qPCR) was performed using SYBR Green I Master (Roche) in a LightCycler® 480 II (Roche) with specific primers (0.2 μM) (S1 Table ). Ct values higher than 40 were excluded from analysis. Data were analyzed using the 2ΔΔCt method [27 (link)] and normalized to Rplp0 expression.
4
Mitochondrial Regulation and Autophagy Evaluation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Human mRNA expressions of PGC-1α, TFAM, MFN1, MFN2, OPA1, LC3, GLO1, and β-actin were determined by real-time PCR analysis. The specific primers for these gene expression were shown in Table 1 . After the drug treatment, cells were harvested and homogenized with Tripure isolation reagents (Roche Applied Science, Indianapolis, IN, USA), and 1 μg of total RNA was reverse transcribed to cDNA with an RT-PCR kit (Promega, Heidelberg, Germany) according to the manufacturer's instructions. Real-time PCR was performed in 96-well plates with the fast start SYBR green master. PCR products were measured with an ABI Quant Studio 5 (Thermo Fischer Scientific, Waltham, Massachusetts, USA).Table 1
qPCR primers.
| Forward primer | Reverse primer | |
|---|---|---|
| GLO-1 | 5-CTAGAGTTCTTGGAATGACGC-3 | 5-ATTGTGGTAACTCTGGGTCTCA-3 |
| PGC1α | 5-CCAAAGATGCGCTCTCGTTCA-3 | 5-CGGTGTCTGTAGTGGCTTGACT-3 |
| TFAM | 5-GTGGTTTTCATCTGTCTTGGCA-3 | 5-TTCCCTCCAACGCTGGGCAATT-3 |
| MFN-1 | 5- GGTGAATGAGCGGCTTTCCAA-3 | 5- TCCTCCACCAAGAAATGCAGG-3 |
| MFN-2 | 5- CCTGCTCTTCTCTCGATGCAA-3 | 5-TGTCTTCAAGGAAGGTGGCG-3 |
| OPA-1 | 5-TGGCCTGGATAGCAGAAAGG-3 | 5-AGGATGTCCTTAATTGGGGTCG-3 |
| LC3 | 5-GCGAGTTACCTCCCGCAG-3 | 5-GTACCTCCTTACAGCGGTCG-3 |
| β-actin | 5-CGGGGACCTGACTGACTACC-3 | 5-AGGAAGGCTGGAAGAGTGC-3 |
5
NaIO3-Induced Retinal Inflammation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The expression of genes encoding IL-1β, IL-6, NLRP3, caspase-3, caspase-7, caspase-8, P2X7 and β-actin were determined by real-time PCR analysis with specific primers (Supplementary Table S1 )Three days after NaIO3 i.p. injection, WT and P2X7−/− mice were sacrificed to collect the whole retina. The whole retina was homogenized with 200 μL of TriPure isolation reagents (Roche Applied Science), total RNA was extracted and 1 μg of total RNA was reverse transcribed with an RT-PCR kit (Promega) according to the manufacturer’s instructions. Real-time PCR was performed in 96-well plates with the Fast Start SYBR Green Master. Each 25 μL PCR well contained complementary DNA (cDNA), Master Mix, gene-specific primers, and passive reference dye (ROX) to normalize the signals from the SYBR Green double-stranded DNA complexes during the analysis and to correct for well-to-well variations. PCR products were measured with an ABI Quant Studio 5 (Applied Biosystems, Foster City, CA, USA).
6
RNA Extraction and qRT-PCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted using Tripure Isolation Reagents (Roche) according to the manufacturer's protocol. Quantity and purity of the RNA were determined by measuring absorbance in 260/280 nm wavelength using NanoDrop spectrophotometer. RNA was then subjected to quantitative reverse transcriptase polymerase chain reaction (qRT-PCR)
7
Total RNA Isolation from Splenocytes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated from splenocytes with Tripure Isolation Reagents (Roche Applied Science, Germany) according to the manufacturer’s instructions.
Samples were incubated for 10 min at room temperature. Then 200 μl chloroform solution was added to the microtubes, and the vortexing intensity was15 sec. It was incubated for 15 min at 4°C in dim light. Samples were centrifuged at 4°C with 12000 rpm for 15 min. Clear supernatant was removed carefully and transferred to the other microtubes. Cold isopropanol 500 μl was added and incubated for 10 min at 4°C in dim light, then centrifuged for 10 min at 12000 rpm and 4°C. At the end of this stage, sediment RNA was visible as a tiny white pellet. The supernatant was removed and washed, the RNA precipitated by alcohol 75%, and then centrifuged at 4°C and 7500 rpm for 5 min. Supernatant was carefully and completely emptied and the remaining ethanol in the microtubes was removed by air flow. DEPS water was added to microtubes containing RNA, and for the duration of 10 min at 56°C was placed on a dry-block device; eventually moved to -20°C and held until cDNA synthesis.
Samples were incubated for 10 min at room temperature. Then 200 μl chloroform solution was added to the microtubes, and the vortexing intensity was15 sec. It was incubated for 15 min at 4°C in dim light. Samples were centrifuged at 4°C with 12000 rpm for 15 min. Clear supernatant was removed carefully and transferred to the other microtubes. Cold isopropanol 500 μl was added and incubated for 10 min at 4°C in dim light, then centrifuged for 10 min at 12000 rpm and 4°C. At the end of this stage, sediment RNA was visible as a tiny white pellet. The supernatant was removed and washed, the RNA precipitated by alcohol 75%, and then centrifuged at 4°C and 7500 rpm for 5 min. Supernatant was carefully and completely emptied and the remaining ethanol in the microtubes was removed by air flow. DEPS water was added to microtubes containing RNA, and for the duration of 10 min at 56°C was placed on a dry-block device; eventually moved to -20°C and held until cDNA synthesis.
8
Real-Time RT-PCR Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To measure specific gene expressions, the primer sequences for IL-1β, NLRP3 and β-actin were synthesized (Table 1 ). Following LPS treatment, the cells were homogenized with 300 μl TriPure Isolation Reagents (Roche Diagnostics), and 2 μg total RNA was reverse transcribed with a RT-PCR kit (Promega, Heidelberg, Germany), in accordance with the manufacturer instructions. The FastStart SYBR Green Master was used to perform the real-time PCRs in 96-well plates, and an ABI Prism 7900 was used to determine the PCR products.
List of primer sequences used for real-time RT-PCR analysis
| Gene | Forward sequence (5′–3′) | Reverse sequence (3′–5′) |
|---|---|---|
| il-1β | GCTTCAGGCAGGCAGTATCAC | CGACAGCACGAGGCTTTTT |
| nlrp3 | AGAGAATGAGGTCCTCTTTACCATGT | AGCCCCGTGCACACAATC |
| β-actin | CGGGGACCTGACTGACTACC | AGGAAGGCTGGAAGAGTGC |
9
RNA Extraction and cDNA Synthesis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted with TriPure Isolation Reagents (Roche, Mannheim, Germany) according to the manufacturer's protocol. Purity and concentration of the RNA were determined by measuring 260/280 absorbance ratios using a spectrophotometer (DU 730 Beckman Coulter, Fullerton, USA). Complementary DNA (cDNA) synthesis was achieved using the Transcriptor First Strand cDNA Synthesis Kit (Roche) with oligo-dT primers according to the manufacturer's protocol.
10
Quantitative RT-PCR Analysis of Immune Markers
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The RNA extracted from splenocytes (5 × 106 cells) was mixed with 1 ml of Tripure Isolation Reagents (Roche Applied Science, Germany), and cDNA was prepared with cDNA Synthesis Kit (Fermentas, Germany) according to instructions, for quantitative real-time analysis.
Primers and quantitation probes for β2- Microglobulin (β2M), Interferon gamma (IFN-γ), IL-4, IL-17, FOXP3 and Transforming growth factor beta (TGF-β), were designed using the Beacon Designer software Version 7.9. The primers and probe are mentioned in Table1 .
Real-time PCR was performed using TaqMan PCR Mastermix and pre-formulated primers for mentioned genes and β2M by Rotor Gene Q Real-Time PCR machine (Corbett Research, Australia). The results were analyzed by the comparative threshold cycle method and normalized by β2M as an internal control with Rotor Gene 6000 software (Corbett Research, Australia). Using the below equation, the fold change in expression of gene of interest for each group was calculated: mean of gene of interest normalized. Index of test group/mean of gene of interest normalized index of healthy controls.
Primers and quantitation probes for β2- Microglobulin (β2M), Interferon gamma (IFN-γ), IL-4, IL-17, FOXP3 and Transforming growth factor beta (TGF-β), were designed using the Beacon Designer software Version 7.9. The primers and probe are mentioned in Table
Real-time PCR was performed using TaqMan PCR Mastermix and pre-formulated primers for mentioned genes and β2M by Rotor Gene Q Real-Time PCR machine (Corbett Research, Australia). The results were analyzed by the comparative threshold cycle method and normalized by β2M as an internal control with Rotor Gene 6000 software (Corbett Research, Australia). Using the below equation, the fold change in expression of gene of interest for each group was calculated: mean of gene of interest normalized. Index of test group/mean of gene of interest normalized index of healthy controls.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!