The insert RFP was recovered from a plasmid mTAG-RFP digested with the enzymes NheI (Fast Digest; Thermo Fisher Scientific)/BsGrI(Fast Digest; Thermo Fisher Scientific) or NheI/XhoI (Fast Digest; Thermo Fisher Scientific). Meanwhile, the plasmids EGFP-ORP∆TM and EGFP-ORP5B were respectively digested with the enzymes NheI/BsrGI and NheI/XhoI to remove the tag EGFP. The insert RFP was then ligated on the plasmid without the tag.
Fastdigest
Manufactured by Thermo Fisher Scientific
Sourced in United States, Lithuania, Canada, Germany
FastDigest is a line of restriction enzymes designed for rapid DNA digestion. These enzymes are engineered to provide quick, reliable, and efficient cleavage of DNA samples. They are suitable for a variety of molecular biology applications that require fast and accurate DNA fragmentation.
Automatically generated - may contain errors
Lab products found in correlation
T4 dna ligase, by Thermo Fisher Scientific (13 mentions)
Phusion high fidelity dna polymerase, by Thermo Fisher Scientific (6 mentions)
T4 dna ligase, by New England Biolabs (3 mentions)
Nanodrop nd 1000 spectrophotometer, by Thermo Fisher Scientific (3 mentions)
T4 ligase, by Thermo Fisher Scientific (2 mentions)
Nanodrop 1000, by Thermo Fisher Scientific (2 mentions)
X tremegene hp dna transfection reagent, by Roche (2 mentions)
Fastap thermosensitive alkaline phosphatase, by Thermo Fisher Scientific (2 mentions)
Phusion polymerase, by Thermo Fisher Scientific (2 mentions)
Genejet gel extraction kit, by Thermo Fisher Scientific (2 mentions)
Fastap, by Thermo Fisher Scientific (2 mentions)
Pcr purification kit, by Qiagen (2 mentions)
Fd0524, by Thermo Fisher Scientific (2 mentions)
Qiaquick pcr purification kit, by Qiagen (2 mentions)
Sapphireamp fast pcr mix, by Takara Bio (2 mentions)
Gblock, by Integrated DNA Technologies (2 mentions)
Dpni fast digest, by Thermo Fisher Scientific (2 mentions)
User enzyme, by New England Biolabs (2 mentions)
Revertaid first strand cdna synthesis kit, by Thermo Fisher Scientific (2 mentions)
In fusion hd cloning kit, by Takara Bio (2 mentions)
88 protocols using fastdigest
1
Cloning RFP into EGFP-ORP Plasmids
2
AFLP Molecular Marker Technique
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
AFLP was carried out as described by Vos et al.
[34 (link)] and Wimmers et al.
[27 (link)]. The sequence of the adapter and primers were used as described in the previous study
[35 (link)]. Genomic DNA (250 ng) was digested with TaqI (FastDigest®, Fermentas) at 65°C for 5 minutes and EcoRI (FastDigest®, Fermentas) at 37°C for 5 minutes. Adapters were ligated to the restriction fragments by a ligation reaction containing 1 U of T4 DNA ligase (Fermentas), 10 pmol of double-stranded EcoRI adapter and 100 pmol of double-stranded TaqI adapter. The reactions were incubated at 20°C for 3 hours and then at 4°C overnight
[30 (link)]. The amplification condition was performed with two rounds of preamplification and selective amplification. The preamplification was carried out with an EcoRI-N primer (E + A) and the TaqI-N primer (T + C). The selective amplification was performed with 64 primer combinations (EcoRI-ANN and TaqI-CNN). The reaction was added with loading dye (98% formamide, 10 mM EDTA, 0.025% xylenecyanol and 0.025% bromophenol blue) and denatured at 95°C for 5 minutes then immediately cooled on ice. The AFLP products were separated with 6% denaturing polyacrylamide gel electrophoresis at constant power (50 W) for 3 hours. The AFLP fingerprints were visualized by silver staining.
[34 (link)] and Wimmers et al.
[27 (link)]. The sequence of the adapter and primers were used as described in the previous study
[35 (link)]. Genomic DNA (250 ng) was digested with TaqI (FastDigest®, Fermentas) at 65°C for 5 minutes and EcoRI (FastDigest®, Fermentas) at 37°C for 5 minutes. Adapters were ligated to the restriction fragments by a ligation reaction containing 1 U of T4 DNA ligase (Fermentas), 10 pmol of double-stranded EcoRI adapter and 100 pmol of double-stranded TaqI adapter. The reactions were incubated at 20°C for 3 hours and then at 4°C overnight
[30 (link)]. The amplification condition was performed with two rounds of preamplification and selective amplification. The preamplification was carried out with an EcoRI-N primer (E + A) and the TaqI-N primer (T + C). The selective amplification was performed with 64 primer combinations (EcoRI-ANN and TaqI-CNN). The reaction was added with loading dye (98% formamide, 10 mM EDTA, 0.025% xylenecyanol and 0.025% bromophenol blue) and denatured at 95°C for 5 minutes then immediately cooled on ice. The AFLP products were separated with 6% denaturing polyacrylamide gel electrophoresis at constant power (50 W) for 3 hours. The AFLP fingerprints were visualized by silver staining.
3
Generation of Nodal Overexpression and Knockdown Constructs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To generate Nodal-overexpressed plasmid, the full-length cDNA of Nodal was amplified by PCR, double digested with Xhol I and BamH I (FastDigest, MBI Fermentas, Canada) and cloned into the Xhol I/ BamH I sites of the vector pcDNA3.1(-)-myc-his with T4 DNA Ligase (FastDigest, MBI Fermentas).
To generate the siRNA expression construct of Nodal, three siRNA sequences (GenScript, China) were cloned into the pGCU6/Neo/RFP vector respectively. One of the most effectively silenced plasmids (siRNA sequence for Nodal: AUCUGAAACCGCUCUAAGCAG, 423-445) was chosen for the following studies.
Recombinant plasmid DNA (4 μg) and 8 μl of the X-treme GENE HP DNA Transfection Reagent (Roche, USA) were mixed with 200 μl of medium without antibiotics and FBS and incubated at room temperature for 10 min. Then, this mixture was added to the cells without removing the growth medium. The pcDNA3.1 (-)-myc-his and pGCU6/Neo/RFP vectors were used as vector controls. After 24h, the transfected cells were selected using G418 (Ceresco, USA) at a concentration of 1000 mg ml -1 and persistently cultured with G418 at a concentration of 200 mg ml -1 .
To generate the siRNA expression construct of Nodal, three siRNA sequences (GenScript, China) were cloned into the pGCU6/Neo/RFP vector respectively. One of the most effectively silenced plasmids (siRNA sequence for Nodal: AUCUGAAACCGCUCUAAGCAG, 423-445) was chosen for the following studies.
Recombinant plasmid DNA (4 μg) and 8 μl of the X-treme GENE HP DNA Transfection Reagent (Roche, USA) were mixed with 200 μl of medium without antibiotics and FBS and incubated at room temperature for 10 min. Then, this mixture was added to the cells without removing the growth medium. The pcDNA3.1 (-)-myc-his and pGCU6/Neo/RFP vectors were used as vector controls. After 24h, the transfected cells were selected using G418 (Ceresco, USA) at a concentration of 1000 mg ml -1 and persistently cultured with G418 at a concentration of 200 mg ml -1 .
4
Plasmid Extraction and Fragment Preparation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Supercoiled plasmids were extracted from E. coli XL1-Blue using NucleoSpin Plasmid (Macherey-Nagel) or NucleoBond Xtra Midi (Macherey-Nagel) accordingly to the manufacturer instructions. Relaxed pCB568 and pCB598 were obtained by Nt.BspQI digestion (NEB) followed by a column purification (NucleoSpin Gel and PCR clean-up, Macherey-Nagel). ScaI and PvuII pCB568 fragments were obtained by ScaI and PvuII digestion (FastDigest, ThermoFisher) followed by a gel purification of the desired fragment (NucleoSpin Gel and PCR clean-up, Macherey-Nagel). Linear pCB598 was obtained by ScaI digestion (FastDigest, ThermoFisher) followed by a gel purification (NucleoSpin Gel and PCR clean-up, Macherey-Nagel). A 2,106-bp fragment of pCB568 was amplified by Phusion Polymerase (ThermoFisher) with the primers pUC1481-1503 and P30-REV followed by column purification (NucleoSpin Gel and PCR clean-up, Macherey-Nagel). The various fragments of 800 bp were amplified from the appropriate plasmid by Phusion Polymerase (ThermoFisher) with the primers pUC195-217 and pZE21_rev followed by column purification (NucleoSpin Gel and PCR clean-up, Macherey-Nagel).
5
Preparation of Dux and Luciferase cRNAs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
In vitro transcription (IVT) was performed to prepare cRNAs encoding Dux, DuxG1, DuxG9, and firefly luciferase (Luc), which had been prepared previously. The expression vectors containing Dux, DuxG9, and Luc were treated with the restriction enzyme EcoRV (FastDigest, Thermo Fisher Scientific Inc.). The expression vector containing DuxG1 was treated with SpeI (FastDigest, Thermo Fisher Scientific Inc.). They were purified by phenol chloroform/ethanol precipitation. Thereafter, IVT was performed using a T7 or Sp6 mMESSAGE mMACHINE (Thermo Fisher Scientific Inc.), according to the manufacturer’s instructions. After adding a poly (A) tail to the transcribed cRNA using a Poly (A) tailing kit (Thermo Fisher Scientific Inc.), the cRNA was purified using a lithium chloride precipitation solution and dissolved in nuclease-free water.
6
Cloning and Expression of Bacterial SMases
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The coding sequences for the native SMases from H. lepturus (A0A1L4BJ98) and L. rufescens (C0JB02.1), as well as the designed cSMase were codon‐optimized for expression in Escherichia coli and purchased from Eurofins Genomics. All genetic constructs included the sequences NcoI‐6xHis and STOP‐BamHI in the 5′ and 3′ ends, respectively. The genetic constructs were subcloned into the pET 6xHis TEV cloning vector (Addgene #29653) using standard restriction and ligation cloning procedures. Briefly, both plasmid and genetic constructs were digested with NcoI and BamHI restriction enzymes (FastDigest, Thermofisher), inactivated (5 min at 65°C), and purified from agarose gel (GeneJET Gel Extraction Kit). Purified fragments were mixed in a 1:5 ratio (vector: insert) for ligation with T4 ligase, following the manufacturer recommendation (New England Biolabs). E. coli 10G Chemically Competent Cells (Lucigen) were transformed with the ligation mixtures and plated on LB plates containing 50 μg kanamycin (LB‐Kan) (Sigma‐Aldrich). Plasmids from four colonies with the expected electrophoretic pattern after analytical digestion with NcoI/BamHI (FastDigest, Thermofisher) were Sanger‐sequenced by Eurofins Genomics. The constructs were named pET‐6xHis‐rHl, pET‐6xHis‐rLr, and pET‐6xHis‐cSMase.
7
Overexpression of MACC1 with GFP
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The plasmid RC224774L2 (Origene, Rockville, Maryland) was used to create cytomegalovirus (CMV) promoter-driven overexpression of human MACC1 (NM_182762) as a C-terminal GFP fusion protein. Parallel deletion of N-terminal CME binding sites occurred via Gibson assembly of a synthesized dsDNA fragment (Integrated DNA Technology, Leuven, Belgium) spanning 96 nt upstream of the MACC1 start codon (homologous to the vector sequence), missing the nucleotides 64–80 (clathrin box), 193–201 (NPF), 222–230 (NPF) and 295–303 (DPF), and ends at nucleotide 434 downstream of the MACC1 start codon. The vector was gapped with the restriction enzymes SfaAI and BseJI (Fast Digest, Thermo Scientific). A region around the previously described deletion of the SH3 domain of MACC1 [4 (link)] was amplified and cloned via Gibson assembly into the target vectors, gapped with the restriction enzymes XhoI and PshAI (Fast Digest, Thermo Scientific). The exact sequences of the synthesized fragment, the primers or the generated vectors are available on request.
8
Genetic Polymorphism Detection via PCR-RFLP
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
PCR-RFLP was used to study SNP of MTHFR C677T and MTR A2756G genes. SNP in these genes creates a specific restriction sites and PCR-RFLP method uses restriction enzymes to identify the presence of polymorphism. Primers were designed in such a way that on restriction digestion of the PCR product, two bands of unequal size would be formed for easy visualization and analysis on agarose gel. The restriction enzymes used for SNP C677T of MTHFR gene was HinFI (FastDigest, Thermo Scientific). On digestion with HinFI restriction enzyme, the PCR product of 349bp of MTHFR gene, produced two bands (208bp and 141bp) in the presence of ‘T’ allele at position 677 (Figure S1A). The restriction enzymes used for SNP A2756G of MTR gene was HaeIII (Fast Digest, Thermo Scientific), on digision using HaeIII, the PCR product of 350bp of MTR gene yielded two distinct bands of 218bp and 132bp in the presence of ‘Allele at position 2756 (Figure S1B).
9
Plasmid Digestion and Characterization
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Digestion of the plasmid vector pEASY-Blunt E1 and gene insert SpSKF4 was done using appropriate Fast Digest restriction enzymes (Nde1 and Sac1) in the presence of a compatible buffer 10X Fast Digest buffer (Thermo Scientific Fast Digest, USA) at 37°C for 30 min. The digested product was checked with 12% agarose gel.
10
Synthetic Operon Assembly Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
All plasmids are listed in Supplementary Table 1 and their constructions were followed the method in ref. 31 . Heterologous gene sequences were listed in Supplementary Data 3 . fucA, rhaD, fbaA and yihT were cloned from E. coli MG1655 genome with primers listed in Supplementary Data 2 . All genes were inserted into pNivC plasmid individually under a ribosome binding site “C” (AAGTTAAGAGGCAAGA). Apart from lerK and eltD, all others have a 6xHis-tag right after the start codon. Genes were then assembled into an operon via BioBrick enzymes: BcuI, SalI, NheI and XhoI (FastDigest, Thermo Scientific). EcoRI and PstI (FastDigest, Thermo Scientific) were used to move the whole operon to an expression vector (pZ plasmid), which has a synthetic promoter pgi-20 or pgi-10, p15A medium copy origin as well as streptomycin selection marker.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!